1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spayn [35]
3 years ago
11

Which of the following is a method used to prevent soil erosion? A. Tilling the soil / B. Contour farming / C. Adding worms to s

oil / D. Adding fertilizers to soil
Biology
2 answers:
lapo4ka [179]3 years ago
8 0

Answer: B. Contour farming

Explanation:

Contour farming is a sustainable practice of conserving the soil from erosion so as to retain it's fertility for the next harvest.  In this method plants are grown over the contours of the slopes at a slight elevation. This process allows the absorption of water by the soil and prevents the surface runoff. Hence, prevents the loss of soil fertility by soil erosion due to water.

skad [1K]3 years ago
5 0
I'd say
B. Contour Farming 
since it's planting on a flat surface and creating w/ridges to help prevent water from taking the crops away
You might be interested in
What are the two main classification of ecosystems?
Sonbull [250]
B. Terrestrial and Aquatic
4 0
3 years ago
Do inner planets have a rocky surface
GREYUIT [131]

Answer:

Yes

Explanation:

6 0
3 years ago
Read 2 more answers
The comparison of the actual amount of water vapor in the air to the maximum amount of water vapor the air could hold is called
Serhud [2]

Answer:

D.

Explanation:

This amount of space in air that can hold water changes depending on the temperature and pressure.

8 0
3 years ago
Read 2 more answers
To have enough DNA for each gamete, the DNA in the germ cell must be?
trasher [3.6K]

Answer: To have enough DNA for each gamete, the DNA in the germ cell must be <u>Doubled (x2).</u>

Hope this helps!

7 0
2 years ago
Actin filaments are part of the contractile machinery in smooth muscle cells of eukaryotic organisms. Which organelle is respons
TEA [102]
<span>The interaction of motor proteins such as dynein, is responsible for the movement of organelles in cells which uses energy to move parts of the cytoskeleton.  Cytoskeleton is a network of intermediate filaments, microtubules and microfilaments that outspread throughout the cytoplasm and serve a variety of signaling, transport and mechanical functions.</span>



8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • An individual sustained a closed head injury in a rock climbing accident. In the ER the RN elevates the head of the bed at 30 de
    10·1 answer
  • What structures make up the general structure of cardiac muscle cells?
    8·1 answer
  • A ____ virus mutates with every infection, thus making them difficult to locate
    8·1 answer
  • Need Help ASAP. You are holding a rock tied to a string, which is an example of the pendulum in this example. ( Will Mark Brainl
    9·1 answer
  • What is a vascular plant? what is a vascular plant?
    12·2 answers
  • 3 examples of non-living things that can disrupt homeostasis
    10·1 answer
  • Based on the data shown in the weather map, a cold front is most likely about to pass through which state
    13·1 answer
  • PLEASE HELP ME <br> What are the steps to photosynthesis
    5·2 answers
  • In which cell structure are ribosomes produced
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!