1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
3 years ago
8

DESCRIBE THE RELATIONSHIP BETWEEN FORCE,Energy, and Morion

Biology
1 answer:
gizmo_the_mogwai [7]3 years ago
6 0

Answer:force energy and motion are interrelated with each other. When two objects interacting through a force field change relative position ,the energy stored in the force field is changed.Each force between the two interacting objects acts in the direction such that motion in that direction would reduce the energy in the force field between the objects

Explanation:

Hope it helps

You might be interested in
Omg i need the answer lol
galina1969 [7]

Answer:

Force is a measure of power. Velocity, on the other hand, is a quality an object has. Apply force to an object, and its velocity changes.

6 0
2 years ago
while gazing into an aquarium, you see bubbles from an aquatic plant. What is the name of this effect?
liraira [26]

Hydrophonic plants are plants that is living in the lands, and obviously the aquatic plants that are typically used to style aquariums. However, the bubbles you can perceive in an aquatic plant can perhaps be a source of oxygen which is recognized as one of the products of plants as well as human respiration. The bubbles are oxygen and are created from the thylakoid membrane in the chloroplast over photosynthesis.

5 0
3 years ago
What is menopause, and why does it occur?
katovenus [111]

Answer:

A woman is born with all of her eggs, which are stored in her ovaries. The ovaries also make the hormones estrogen and progesterone, which control her period (menstruation) and the release of eggs (ovulation). Menopause happens when the ovaries no longer release an egg every month and menstruation stops.

5 0
3 years ago
Read 2 more answers
During thermohaline circulation, what two things are transported around the globe? Choose two.
9966 [12]

Answer:energy in the form of heat and matter (nutrients, solids, dissolved substances, and gases)

Explanation:

6 0
3 years ago
What was the sequence of human migration across the planet?
prisoha [69]
Human migration is the movement over long distances, movement from one country/region  to another ) by people . Humans moved because of the c<span>hanging climate and landscape and inadequate food supply. </span>The first human movement was t<span>he movement of </span>Homo erectus<span> out of Africa across </span>Eurasia<span> about 1.75 million years ago. </span> 
Than industrialization<span> encouraged migration wherever it appeared.
Wars also created migration. (</span><span>The First and Second World Wars, and wars, genocides, and crises sparked by them, lead to migrations).</span>
7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How were American farmers in the 1940s impacted by new technology? a. They were able to increase their productivity due to the p
    12·1 answer
  • An element is made of many different types of atoms all together.<br><br> True <br> False
    13·2 answers
  • A loss of _____ of body weight can reduce or prevent the risks associated with obesity.
    5·1 answer
  • Why is color-<br> blindness more common in men than in women?
    11·1 answer
  • Which claim would most likely be considered valid? A company that says its vitamin water has tested better than most energy drin
    6·2 answers
  • Which of the following phenomena is taking place when sound waves are reflected from a surface along parallel lines?
    11·1 answer
  • Which of the following is the most important characteristic that biologists use to classify animals?
    7·1 answer
  • What is the process called ?
    9·2 answers
  • Determine whether each statement correctly describes the myocardial action potential and the pacemaker potential. 1. Because the
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!