1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
3 years ago
10

PLEASE HELP

Biology
2 answers:
Olenka [21]3 years ago
7 0
The correct option is C
harina [27]3 years ago
7 0

Answer:

Your answer is C. military failures in the Russo-Japanese war and World War I hopefully this helps!

You might be interested in
What is the name of this chemical reaction?
maxonik [38]
The answer is c
Reason: that’s what happens when the hit hits plants. That’s how they eat
8 0
3 years ago
Which statement best defines micronutrients
Rudik [331]

a chemical element or substance required in trace amounts for the normal growth and development of living organisms.

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which part of the compound light microscope provides the light source? (4 points)
Andreas93 [3]

Answer: The answer is Part F. Hope this helps :)

Explanation:

7 0
3 years ago
A particular estuary shows periodic changes in the coloration of water. During the summer, water in the estuary appears greener
natta225 [31]

Answer:

im pretty sure that the answer is b, because the plankton decrease growth in the winter.

hope this helps, plz vote me the brainliest :)

Explanation:

4 0
3 years ago
Other questions:
  • Which of the following processes releases carbon into the air?
    5·1 answer
  • Which one of the following most closely approximates the number of replicons in a human focus of replication?a. 1b. 50c. 100d. 3
    11·1 answer
  • Which end of an earthworm contains an organ that can detect smells?
    5·2 answers
  • The cell theory teaches that _____.
    10·2 answers
  • I need help with my biology homework I need to answer this question a student is given a tube containing a liquid nutrient mediu
    10·1 answer
  • Which set of features below best describes the radiolaria?
    13·1 answer
  • Which is an example of how the perpheral nervous system helps the body maintain its internal environment
    8·1 answer
  • transcribe the highlighted portion of DNA into mRNA transcription mRNA copies of DNA into RNA using complementary bases
    7·2 answers
  • How yall doin and do yall wannna talk rn
    13·2 answers
  • What could cause a person with brain cancer to have lost balance and decreased coordination?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!