1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nikitich [7]
4 years ago
13

When a warm air mass is caught between two cooler air masses, what is this type of front called?

Biology
1 answer:
Citrus2011 [14]4 years ago
5 0

the answer is Occluded Front

You might be interested in
Which government agency would you expect to be most concerned with the impacts of pollution?
vampirchik [111]

Probably the U.S. Environmental Protection Agency also known as the EPA.  They are charged with protecting people and the environment by enforcing regulations that prevent pollution.  If they find any violation committed they can impose sanctions and fines as well as imprisonment depending on the nature of the offense.

4 0
4 years ago
Mention two similarities between haemolysis and plasmolysis
Otrada [13]
1. Both are caused my osmosis
2. Both involve in the destruction of the cell (plasmolysis occurs in place cell walls and heamolysis occurs in red blood cells of animals
3 0
3 years ago
Read 2 more answers
Which examples are signs of a disease
nexus9112 [7]

Answer:

Keep in mind that any objective evidence of a disease, such as a skin rash or a cough, is a sign.

Explanation:

There are several signs that may conduct a disease. Some of them are fever, cough, high blood pressure, a rash, among others.

7 0
3 years ago
Read 2 more answers
Describe how a change in dna sequence could result in a changed sequence of amino acids in a protein.
egoroff_w [7]
A change in DNA could result in a changed sequence by the amount of atoms and chemicals in the DNA
8 0
3 years ago
The client with a laryngectomy does not want to be observed by the family because the opening in the throat is "disgusting." the
Akimi4 [234]
The nurse should further explore why does the patient think that the opening in his/her throat is disgusting. From this, the nurse can modify her teaching plan. This will also help the patient understand how important it is to care for the wound as well as to assess if the operation had psychological effects on the patient.
5 0
4 years ago
Other questions:
  • What does a plant cell have that an animal cell does not
    15·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Two genes of a flower, one controlling blue (b) versus white (b) petals and the other controlling round (r) versus oval (r) stam
    15·2 answers
  • Fill in the blank.
    13·1 answer
  • HELP ME PLS OMG HELP ME PLS!
    12·1 answer
  • Identify the following statements as True or False.
    11·1 answer
  • Why do you think slate might be denser then shale?​
    5·2 answers
  • What's the food diet of a boa constrictor​
    5·2 answers
  • Flagella are like <br> 1. arsm and hands<br> 2skeletel system or<br> 3legs
    8·2 answers
  • 13. What innovation did Jethro Wood add to plows in the 1800s?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!