1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
3 years ago
15

Mira analyzed oxygen and carbon dioxide in inhaled and exhaled air. She found that the percentages of both gases were different

Biology
1 answer:
sashaice [31]3 years ago
6 0

Answer:

ozone

Explanation:

found in the atmosphere

You might be interested in
Cell theory is based on a series of discoveries. In 1655, Robert Hooke coined the word "cell" from his investigations of cork ce
S_A_V [24]
C seems like the best choice here. Choice C because Pastuer has added a new portion to the cell theory eased on his new scarification findings. Therefore, scientific theories can be modified with new empirical data. A theory is just an argument widely agreed upon, not exactly a proven piece of information.
8 0
3 years ago
Read 2 more answers
What happens after step (iv) in the diagram shown below?
Alexandra [31]
The answer is B!!!! it’s pretty easy
6 0
2 years ago
How could the movement of tectonic plates create another supercontient
Butoxors [25]
Do you know what a pangea is well Pangea is another supercontinent the reason why we're not Pangea is because something dead which oceans with lava cools off it cools off from old to new the new rocks are pushing the consonants together and eventually and a couple of million years it will be Pangaea again
8 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Haven't Answered a Question lately So I'll ask
Rina8888 [55]

Answer:

cheetah golden eagle white throated needletail Swift

3 0
2 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP ASAP!!! WILL MARK BRAINLIEST!!!
    14·1 answer
  • If the finches that colonized the Galápagos from South America had different allele frequencies when compared to the parental po
    6·1 answer
  • How has a rise on global temperature impacted the life of the polar bear? A rise in temperatures has disrupted the Arctic food c
    12·1 answer
  • What would two different species
    7·1 answer
  • Plz answer the questions for me!!!!!!!
    8·1 answer
  • How many gallons of water did the population of Atlanta use per day in 1980?
    13·1 answer
  • For cells and cellular components- Mitochondrion, Animal cell, ATP, O2, Hexokinase (an enzyme that phosphorylates hexoses (six-c
    6·1 answer
  • Why environmental health is a community issue​
    6·1 answer
  • If we penetrate a plant and an animal cell, which one of them would lose its shape?
    8·1 answer
  • What is the cause of death for socrates plants
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!