1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nalin [4]
3 years ago
10

Which of the following characteristics is NOT true of cold fronts?

Geography
2 answers:
yawa3891 [41]3 years ago
7 0

Answer: The correct answer is <u><em>D. They move more slowly than warm fronts.</em></u>

Daniel [21]3 years ago
3 0
A cold front<span> is the transition zone where a </span>cold<span> air mass is replacing a warmer one
</span>T<span>hey move more slowly than warm fronts.</span>
Because other three are characteristics of the  cold front  and they move faster than warm
so option D is correct
hope it helps
You might be interested in
What caused the volcanic mountains of hawaii to form?.
aivan3 [116]
It’s was caused by the volcanic mountain
3 0
2 years ago
Explain how Islam became part of North African cultures.
rewona [7]

Answer:

Islam became part of North African cultures due to the geographical location and also due to the spread of refugees from Saudi Arabia and other countries in Asia. North Africa was the first country(well one of the first) that Islam spread to other than Asia.

Explanation:

6 0
4 years ago
Longitude is measured in degrees, hours, and seconds. true false
Mekhanik [1.2K]
Its true!! It is measured in seconds Minutes And Degrees. Hope it helped u!!
6 0
3 years ago
How can the information on this map be used to provide evidence for the continental drift theory?
uysha [10]

Answer:

c

Explanation:

7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What is the dominant climate of Mexico? What are its main physical features?
    13·1 answer
  • Is this statement true or false?
    6·1 answer
  • During the light-independent reaction, carbon dioxide is fixed by adding it to a
    12·1 answer
  • The photo above shows a flat, open space. Which landform is shown in this photo?
    7·2 answers
  • Which type of volcano is most likely to form fluid lava?
    9·2 answers
  • Why was the concern over global cooling replaced with a concern over global warming?
    8·2 answers
  • Why do Bali and Lombok have very dissimilar vegetation and animal life?
    8·1 answer
  • 2. Before life evolved adaptations for living on the land, a major change in one of Earth's systems took place.
    9·1 answer
  • Human beings originated from a long process of biological and cultural evolution this process called:
    14·1 answer
  • Which force of weathering is the main cause of landslides
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!