1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weeeeeb [17]
4 years ago
13

Someone please help Im struggling

Biology
1 answer:
Blababa [14]4 years ago
7 0

The answer is probably B) can produce fertile offspring

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
I don't know what this is I need help
Bas_tet [7]

to be honest me neither dude

4 0
2 years ago
Traits, conditions, or diseases that are passed down through families through one of the X or Y chromosomes.
jonny [76]
Traits that are passed down on an X or a Y chromosome are sex-linked traits. Most of the time males are affected by sex-linked traits because males only have one X and a Y. The Y is the chromosome that makes a man, a man.
6 0
3 years ago
Read 2 more answers
his geologic era is known as the age of aquatic plants and animals. a. Precambrian b. Mesozoic c. Cenozoic d. Paleozoi
german

Answer:d.Paleozoic Era

Explanation:

Paleozoic Era is hallmarked by climate, animals & plants.

This Era includes the Ordovician Period, Silurian Period and the Devonian Period.

The Silurian Period is one during this era where aquatic plants and animals evolved.

5 0
3 years ago
Which is true about fossils and rocks found in the same layer(strata)?
AURORKA [14]

Answer:

B.) They have the same color and texture.

7 0
3 years ago
Other questions:
  • In which order will free nucleotides add on to a single strand of DNA with the sequence ATTGCA during DNA replication?
    11·1 answer
  • When calcium blood levels fall, a gland in the body releases a special hormone. This is a positive feedback loop, which means __
    10·2 answers
  • In a population of plants with a diploid number of 12, a new individual appeared with a chromosome number of 24. If this organis
    13·1 answer
  • Which of the following statements is not true about G-protein coupled receptors?
    14·1 answer
  • Climate
    15·2 answers
  • The student chewed the bread and kept it in test tube and added few drops of Iodine solution​
    7·1 answer
  • if the half life of substance z is 2.5 years how long will it take for 48 grams of substance z to decay such that only 3 grams r
    12·1 answer
  • Which description best characterizes a mass extinction?
    14·2 answers
  • What is a template for a rna sequence
    15·1 answer
  • What does the phrase, “When it pours, the desert stores” refer to?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!