1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KengaRu [80]
3 years ago
15

1. A normal mammalian cell will shrink if it is placed into_________. (Assume all solutes are non-penetrating) A. pure water B.

50 mM glucose C. 150 mM NaCl D. 200 mM NaCl E. 300 mM glucose
Biology
1 answer:
GrogVix [38]3 years ago
4 0

Answer:

B. 50 mM glucose; E. 300 mM glucose

Explanation:

In order for the cell to shrink the concentration of solutes in the blood should be above normal or higher than the intracellular concentration, so that water moves from the inside of the cell to the outside by the process known as osmosis.

The normal blood levels of NaCl = ~ 154 mM; therefore A, C and D will not cause any shrinkage.

The normal blood levels of glucose = ~ 3.9 to 7.1 mM; therefore water would move from the intracellular to the extracellular space since the solutes are 10x higher outside the cell, causing shrinkage of the cell.

You might be interested in
Wolves, a natural predator of deer, were not found in Yellowstone Park for
Sliva [168]

Answer:

becuase if the deer over populate they will eat more that is laymans terms so yeah

Explanation:

3 0
4 years ago
The rules that govern _____ describe the sound sequences that can occur in a language
Aliun [14]
The rules that govern phonology describe the sound sequences that can occur in a language. Phonology is the science of speech sounds that constitute the fundamental components of a language. It is also the study of sound relationships within a language or between languages in the world.
5 0
4 years ago
What is embryology?<br> Your own word
Dahasolnce [82]

Answer: The branch of biology and medicine concerned with the study of embryos and their development.

Explanation:

Reword that and mark me brainliest

8 0
3 years ago
The organelle responsible for receiving, packaging, and shipping proteins is called the
zmey [24]
It is c your answer for your questions





3 0
3 years ago
Read 2 more answers
What is catalase and where is it found in living organisms?
adell [148]
Catalase<span> is a common enzyme </span>found<span> in nearly all </span>living organisms<span> exposed to oxygen</span>
6 0
3 years ago
Other questions:
  • Which statement is an accurate description of genes? A) Proteins are made of genes and code for DNA B) Genes are made of protein
    5·2 answers
  • After using jelly on a sandwich, you close the jar and place it on a room temperature shelf instead of in the refrigerator. When
    7·2 answers
  • The fossil record shows that two groups of organisms are related
    11·1 answer
  • Name the sources of carbon in the carbon cycle.
    9·1 answer
  • A simple schematic of a dammed river is shown above. In which area of the diagram would there be an increase in silt deposition
    14·1 answer
  • Many biologists debate how a virus should be classified. In 2008, scientists in France discovered that a virus was
    9·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What causes genetic variation to be preserved or eliminated and how does that effect evolution
    8·2 answers
  • I GIVE BRAINLIEST <br><br> Can someone help me in number (8) pls
    8·1 answer
  • A group of scientists determines that a mitochondrial DNA sequence shared by two species has a constant mutation rate. The seque
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!