1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Morgarella [4.7K]
2 years ago
8

In the United States, during what months are tornadoes most likely to occur? a. Tornadoes are most likely to occur during the mo

nths of December and January. b. Tornadoes are most like to occur during the months of April and May, when the Earth’s tilt enhances the differences in pressure and temperatures in the Northern Hemisphere. c. Tornadoes are most likely to occur during the months of August and September. d. Tornadoes are most likely to occur during the months of June and July. e. Tornadoes are most likely to occur during the months of May and June, when temperatures and air pressure begin to reach equilibrium.
Geography
1 answer:
evablogger [386]2 years ago
8 0

Answer:

b. Tornadoes are most like to occur during the months of April and May, when the Earth’s tilt enhances the differences in pressure and temperatures in the Northern Hemisphere.

Explanation:

You might be interested in
Analyze the map below and answer the question that follows. A map of Oceania is titled Oceanic Climate Regions. A key shows 4 ma
Gemiola [76]

Answer:

Option D ( Australia and the Pacific Islands)

Explanation:

The tropical wet and dry climate can be found in Australia and the Pacific Islands.

The weather in these countries is dominated by the tropical wet and dry climate.Australia and the Pacific Islands has two seasons, wet season and dry season which are separated by transition periods, the wet season is characterize with big amount of precipitation, while dry season has along period of dryness. This sort of climate are sometimes called “savanna” climates

3 0
2 years ago
Can someone please help me??? here's a picture.
Novay_Z [31]
There’s no picture.
8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
How did the Mediterranean climate influence culture in the region?
N76 [4]

Answer:

b

Explanation:

8 0
2 years ago
Read 2 more answers
Name for the maximum-size ships that can fi t in the Panama Canal
Anarel [89]
Cargo Capicity i believe
5 0
2 years ago
Other questions:
  • The Pangaea theory supports the theory of plate tectonics because _____.
    10·1 answer
  • Which type of stress is associated with each type of tectonic plate boundary?
    6·2 answers
  • In a survey, the U.S. Bureau of Labor Statistics found that Americans watch an average of 2.7 hours of television per day. Which
    15·1 answer
  • What is deforestation? Does it impact humans? . How does deforestation affect the biological processes and ecological systems? W
    11·1 answer
  • Select the correct answer.
    14·1 answer
  • Where is the largest aquarium in the u.S.?
    9·1 answer
  • A. What is the effect of sewage on surface water in a watershed?
    7·2 answers
  • Por favor resolvam isso
    8·1 answer
  • g The Milankovitch cycles describe the change in ________ because of changes in the ________ of the Earth relative to the Sun.a.
    14·1 answer
  • Please help me I don't understand this question at all.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!