1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
4 years ago
8

A protein has a molecular mass of 400 kDa when measured by gel filtration. When subjected to SDS-PAGE in the absence of dithioth

reitol (DTT), the protein gives three bands with Mr values of 180,000, 160,000 and 60,000. When SDS-PAGE is performed in the presence of DTT, three bands are again formed, this time with Mr values of 160,000, 90,000 and 60,000. What is the simplest explanation for these results?
Biology
1 answer:
Semmy [17]4 years ago
5 0

Answer:

The protein can be separated by different techniques like SDS PAGE, by the use of urea, and dithiothreitol. The urea and dithiothreitol acts as denaturant that can break the disufide bonds present in the protein.

The total molecular pass of protein is 400,000 Da. In absence of SDS three bands are observed with the mass of  180,000, 160,000 and 60,000. But in presence of dithiothreito These values are observed 160,000, 90,000 and 60,000. This might happen that protein consists of four subunits with 160, 90, 90, and 60 kDa. Without DTT 180,000 subunit is unable to reduce into 90K Da and linked through the disulfide bonds. In presence of DTT the 90,000 units are identical and visible at single lane.

You might be interested in
What type of cells typically do not contain cilia and or flagella
kodGreya [7K]
Eukaryotes are the<span> type of cells that typically do not contain cilia or a flagella.
The ones that do are called prokaryotes.</span>
6 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
How does<br> the process of inquiry usually<br> begin?
uysha [10]
There are 4 steps for the Inquiry Process:

1. Understand the problem

2. Create a plan

3. Carry out the plan

4. Look back and reflect

**hope this is what your looking for**
8 0
3 years ago
Read 2 more answers
A woman is in a car accident and not wearing a seatbelt. At the emergency room, the doctor notes that one of her bones has susta
GuDViN [60]

Explanation:

muscles, tendons, and ligaments

8 0
3 years ago
Mri studies of persons using inhalants have revealed that the drug causes changes in brain structure that include
Murrr4er [49]
For the answer to the question above,
Mri studies of persons using inhalants have revealed that the drug causes changes in brain structure that includes <u>"the </u><span><u>Shrinkage of the central nervous system depressant."</u>
</span>
<span>
And this causes</span><span> to slow down central nervous system activity.

</span>



7 0
3 years ago
Other questions:
  • The ion imbalance known as ________ initially leads to ________ in excitable cells
    11·1 answer
  • If the T m for a particular amino acid is 120 mg/100 ml and the concentration of that amino acid in the blood is 230 mg/100 ml,
    10·1 answer
  • How can using a combination of policy tools be more efficient than using one exclusively?
    5·2 answers
  • HELPP
    10·1 answer
  • Plants, monera, and animals are all A.Have cell walls B. In the same kingdom C. In different kingdoms D. Have chloroplast
    14·1 answer
  • Que hacer en tiempo de soledad​
    13·1 answer
  • If you’re good in biology/science, plzzz help!
    10·1 answer
  • What is the term used to describe the increase in the number of individuals in a population?
    6·1 answer
  • What do flowers and runners have in common? how are they different?
    7·2 answers
  • the __________ of a typical vertebra forms the rounded, central portion that faces anteriorly in the human vertebral column.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!