1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slava [35]
3 years ago
5

Which human action has not lead to significant changes in Earth’s biomes?

Biology
1 answer:
Luda [366]3 years ago
7 0
Burial practices has not lead to significant changes in Earth’s biomes.
You might be interested in
Does anyone know any of these answers??!
BigorU [14]

Answer:

free ponts how kind of you

Explanation:

4 0
3 years ago
MULTIPLE CHOICE
mojhsa [17]

Answer:

The correct answer is the growth of the offspring to adulthood.

Explanation:

A life cycle is illustrated as the stages of development, which take place during the lifetime of an organism. A life cycle ceases with the death of an organism. Generally, the animals and plants go through three fundamental stages in their life cycles, beginning as a seed or fertilized egg, developing into an undeveloped juvenile, and eventually turning into an adult.  

During the stage of adulthood, a species will reproduce, forming a new generation. A life cycle can constitute more than three fundamental stages on the basis of the species. For example, the life cycle of a human being comprises five main stages.  

8 0
3 years ago
What is true of an atom's nucleus?
andreyandreev [35.5K]

Answer:

C

Explanation:

It is positively charged and include most of the atom's mass.

8 0
3 years ago
The two structures that limit transpiration are known as
hjlf

The two structures that limit transpiration are known as stomata and guard cells.

8 0
3 years ago
1. What type of succession takes place that increases the biological diversity of an ecosystem? For example, if we started with
professor190 [17]

There are two types of succession that lead to the increasment of the ecosystem:

1. Primary succession is the change in the structure of an ecosystem represented with the increase of the ecological community on an area that has not been previously occupied by an ecological community such as area after the lava flow or glacial lake. The first organisms of primary succession are pioneer plants usually, lichens and mosses.

2. Secondary succession includes the step of removal of pre-existing community and after that, colonization of the new one.  


6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What constitutes a solar system?
    13·1 answer
  • Which of the following is NOT one of Earth's four spheres?
    11·1 answer
  • Please help me with this question
    7·2 answers
  • A person with emphysema will exhibit signs of select one:
    7·1 answer
  • In which of the following can a change be directly observed? A. alleles B. genotypes C. phenotypes D. mutations
    5·1 answer
  • Dna contains the code for passing on genetic traits
    15·1 answer
  • What is the name of the lab tool that is used to transfer a sample to a microscope slide?
    5·2 answers
  • Which of the following substances is neutral?
    12·1 answer
  • Help please!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!