1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
4 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has

a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
marysya [2.9K]4 years ago
5 0

Answer: it will be higher

Explanation:

It will be higher because RNA has a higher thermal stability than DNA

You might be interested in
A type of cellular transport is shown. Which description best identifies this type of cellular transport? Your answer: A.Osmosis
garri49 [273]

Answer:

C

Explanation:

7 0
4 years ago
The goal of the world resource simulation center is best described as _______. a. solving current problems regarding world resou
uysha [10]

The goal of the World Resources Simulation Center (WRSC) is best described as: C. determining how to manage global resources for all humanity.

<h3>What is the World Resources Simulation Center (WRSC)?</h3>

The World Resources Simulation Center (WRSC) can be defined as a non-profit visualization and simulation facility that is saddled with the responsibility of availing individuals an opportunity to view critical trends about global global resources.

This ultimately implies that, the goal of the World Resources Simulation Center (WRSC) is best described as determining how to manage global resources for all humanity.

Read more on global resources here: brainly.com/question/18951815

#SPJ4

4 0
2 years ago
"stress triggered by pleasant stressors is called distress. <br> a. True <br> b. False"
leva [86]
The answer is false.

Distress is a state in which a person shows maladaptive behaviour. This happens because an individual can’t adapt to stressors and the stress they produce. Thus, people under constant distress are often likely to become sick.
<span>
Eustress is the opposite of distress. It is a positive stress that motivates people.</span>
3 0
3 years ago
What are the principles basis of classification?​
mariarad [96]

Answer:

Kingdom

Phylum

Class

Order

Family

Genus

Species

Explanation:

4 0
3 years ago
Read 2 more answers
In 1992, the U.S. Environmental Protection Agency (EPA) introduced ____ as a voluntary labeling program designed to identify and
madam [21]

Answer:

<em>energy star.</em>

Explanation:

Its main objective is to help consumers, businesses, and industry save money and protect the environment through the adoption of energy-efficient products and practices.

3 0
3 years ago
Other questions:
  • Discribe how a neutral atom changes when the number of protons,neutrons,or electrons change
    15·1 answer
  • Can someone help me I need an explanation pleasee
    14·1 answer
  • The principal advantages of asexual reproduction are what
    5·1 answer
  • In mitosis, how does the number of chromosomes in a daughter cell compare to the number of chromosomes in a parent cell?
    14·1 answer
  • Explain the difference between osmosis and diffusion and why each of these are crucial process in a cell.
    11·2 answers
  • Can you get a paperclip to float on water? Does the size of the paper clip matter?
    13·2 answers
  • The data showed that recently the alligator population has decreased. How could the decrease in the alligator population affect
    5·2 answers
  • 5 points
    15·1 answer
  • What is haemoglobin<br>anyone wanna t.al.k​
    10·2 answers
  • Which of these is a process during which the hydrosphere interacts with the exosphere? (4 points)
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!