1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
4 years ago
15

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has

a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?
Biology
1 answer:
marysya [2.9K]4 years ago
5 0

Answer: it will be higher

Explanation:

It will be higher because RNA has a higher thermal stability than DNA

You might be interested in
Negatives about gypsy moths?
elena55 [62]

Answer:

Gypsy moths do not kill trees directly they defoliate them. Severe defoliation can add to other stresses such as weather extremes or human activities. This cumulative stress can leave trees vulnerable to disease or other pest infestation that can cause death.

Explanation:

I HOPE THIS HELPED YOU PLEASE MARK ME AS BRAINLIEST

5 0
3 years ago
Read 2 more answers
you are hiking in yosemite, and you notice there are very small plants growing on the rocks next to a waterfall. you wonder what
gtnhenbr [62]
They are a fungi that harvest energy from what they are attached to and can collect the water from the water fall
7 0
4 years ago
Genetics can influence the amount of body fat an individual possesses true or false?
zhuklara [117]

Answer;

The above statement is true.

Explanation;

-Genetics is the study of heredity and how genes are passed from one generation to another . It is among the factors that determine the body fat, others being; exercise, the basal metabolic rate and the basal metabolic index, nutrition, amount and type of activity, age, and sex among other factors.

- One can't change the genes he or she is born with, therefore some individuals are simply built to accumulate more or less fat. Genes can also affect where body fat accumulates as well.



4 0
3 years ago
Read 2 more answers
- Which of the following is an interaction in which<br> both organisms are harmed
vovangra [49]
It would mutualism!!!!!
3 0
4 years ago
Read 2 more answers
Where would you expect to find water stored in a solid form?
nexus9112 [7]
Ice freezer
hope this helps 
god bless
5 0
4 years ago
Read 2 more answers
Other questions:
  • Select all of the statements that apply to healthcare-associated or nosocomial pneumonia to test your understanding of the diffe
    5·1 answer
  • Humans get most of their energy from eating what type of food?
    10·1 answer
  • What are the two main categories of mutations that occurr in humans
    14·1 answer
  • How do the elements in the family compare?
    15·1 answer
  • How do i fo this question
    12·1 answer
  • 9. Michael's grandmother is taking part in an experiment to determine how
    10·2 answers
  • What would this bond be<br>​
    10·1 answer
  • What type of glasses should Eva use in her lab?
    10·1 answer
  • List three activities of a cell that help it live
    14·2 answers
  • Dr. Hincapie recognized that the two larger pieces of DNA— 2100 base pairs and 1800 base pairs—were from plasmids found in bacte
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!