Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
c
Explanation:
because, it just makes sense
Through the process of photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth.
True true true true true true maybe
Hello!
Your answers will be those of the following:
It's Made Of Prokaryotic Cells
Sorry!! I don't know if I missed one, but I also skipped 7th Grade science so even if I did miss one, I hope you pass your test!!