1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlexFokin [52]
3 years ago
15

What is the function of the cell identified with the letter C? Normal adult human blood smear with three different formed elemen

ts identified with letters A through C. Group of answer choices inflammatory response destruction of parasitic worms oxygen transport phagocytosis
Biology
1 answer:
BaLLatris [955]3 years ago
6 0

Answer:

The leukocyte, commonly known as a white blood cell (or WBC), is a major component of the body’s defenses against disease. Leukocytes protect the body against invading microorganisms and body cells with mutated DNA, and they clean up debris. Platelets are essential for the repair of blood vessels when damage to them has occurred; they also provide growth factors for healing and repair.Although leukocytes and erythrocytes both originate from hematopoietic stem cells in the bone marrow, they are very different from each other in many significant ways. For instance, leukocytes are far less numerous than erythrocytes: Typically there are only 5000 to 10,000 per µL. They are also larger than erythrocytes and are the only formed elements that are complete cells, possessing a nucleus and organelles. And although there is just one type of erythrocyte, there are many types of leukocytes. Most of these types have a much shorter lifespan than that of erythrocytes, some as short as a few hours or even a few minutes in the case of acute infection.

Hope this helps :)

Explanation:

You might be interested in
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
What can be said about farmers in highly developed countries?
Serjik [45]

Answer:

c

Explanation:

because, it just makes sense

6 0
3 years ago
Read 2 more answers
Explain how plants are involved in the carbon cycle
8_murik_8 [283]
Through the process of photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth.
8 0
2 years ago
Read 2 more answers
Huge tunnels called burrows carry water into the dam to the fan-like turbines.
slega [8]
True true true true true true maybe
3 0
2 years ago
If you can see an organism without a microscope which of the following do you know is false about the organism ?
Alex Ar [27]

Hello!


Your answers will be those of the following:

It's Made Of Prokaryotic Cells



Sorry!! I don't know if I missed one, but I also skipped 7th Grade science so even if I did miss one, I hope you pass your test!!



6 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP
    15·1 answer
  • Scientists believe that the re-creation of the origin of life in the laboratory would provide important clues to how life began
    8·2 answers
  • For water to travel across the cell membrane at a substantial rate, the water molecules travel through protein channels
    11·1 answer
  • What feature do plants have that provide structure and form? A. Plants have an exoskeleton, like insects. B. Plants have an inte
    5·2 answers
  • Which discorvery did not contribute to cell theory
    12·2 answers
  • "Comparison of conserved sequences among related species usually leads to the identification of ________ sequences, which illust
    15·1 answer
  • Which of the following shows an unsaturated fatty acid?
    15·1 answer
  • 2. How is primary succession different from secondary
    6·1 answer
  • How are a straightedge and compass used to make basic constructions?
    9·1 answer
  • Which two elements make up the most
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!