1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergiy2304 [10]
3 years ago
11

How would an x-ray technician position the camera to produce a frontal view of a patient's abdominal cavity?

Biology
1 answer:
leva [86]3 years ago
8 0

Answer: Option A. "In front of the patient, pointing at his navel"

Explanation:

The X-ray of abdominal cavity is known as Abdominal x-ray. It has same principle as X-ray and uses ionizing radiation to take pictures of inner parts of abdominal cavity such as intestine, stomach, liver and spleen. it is used to diagnose patients with vomiting, unexplained pain, and nausea.

While diagnosing  patient's abdominal cavity, x-ray technician position the camera in front of the patient, pointing at his navel in order to produce a frontal view of abdominal cavity.

Talking about a x-ray machine, it is a compact apparatus which can be taken to the patient in a hospital bed or the emergency room. The x-ray tube connects flexible arm which further extends towards the patient and an x-ray film holder (image recording) plate is placed under the patient.

The technologist will ask the patient to take position on the x-ray table or bed and will position x-ray machine over the abdominal area of the patient, in order to take the frontal view of abdominal cavity. The patient will be asked to hold their breathe to get a clear picture. The technician will turn on the x-ray machine that allows  x-ray machine  to produce a small burst of radiation which passes through the abdominal area and records the frontal view of  patient's abdominal cavity. As a result, soft tissue shows up in shades of gray and air appears black while bones appear white on the x-ray, through which patient can be diagnosed.

Hence, the correct option is A "In front of the patient, pointing at his navel".

You might be interested in
Which pair best matches a type of land cover with an appropriate land use?
shutvik [7]

b is the correct answer.

3 0
3 years ago
Read 2 more answers
A horse has 64 chromosomes and a donkey has 62. Using your knowledge of meiosis, explain why a cross between a horse and a donke
nlexa [21]
Ok, so when a horse (with 64 chromosomes) is crossed with a donkey(that has 62 chromosomes), each parent give its child half of its chromosomes. [64/2=32] [62/2=31]. So the mule gets 31 pairs of chromosomes plus 32 pairs of chromosomes. That equals 63 total chromosomes. In order to be a parent, it must give <span>half of its chromosomes to its child. [63/2=31.5] You can't have half a chromosome, so the mule is a sterile organism. Let me know if you have questions.</span>
8 0
3 years ago
Mendel also wondered if the inheritance of one trait affected the inheritance
svet-max [94.6K]

Answer:

A. dihybrid crosses

Explanation:

A dihybrid cross can be defined as a mating experiment between two lines/varieties/organisms that differ in two phenotypic traits. By using pea plants, Mendel performed dihybrid crosses in order to analyze the mode of inheritance of both phenotypic traits at the same time. From these mating experiments, Mendel observed that the inheritance factors (nowadays called genes) sorted independently from one another in the next generation, which is called the principle/law of Independent Assortment.

8 0
2 years ago
Which part of the brain is responsible for speech?
alexandr1967 [171]

Answer:

<u>C. Broca's Area</u>

Explanation:

Broca’s area is located in the front part of the left hemisphere of your brain. It has an important role in turning your ideas and thoughts into actual spoken words. Broca’s area is the most active Source right before you speak.

Broca’s area also helps to pass the information to another part of your brain called the motor cortex, which controls the movements of your mouth. It’s named after a French doctor, Pierre Paul Broca, who discovered the region of the brain in 1861.

<u>Hope this helps!</u>

5 0
2 years ago
Read 2 more answers
A dieback, or population crash, often occurs after a species _________ its environmental carrying capacity
ozzi
Has died and come back to life
6 0
3 years ago
Read 2 more answers
Other questions:
  • People with damage to the amygdala lose the ability to distinguish between friendly and threatening faces. true
    6·1 answer
  • Oxygen is important in cellular respiration but it does not come into the reaction until the final stage and acts as the?
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A mutation in which types of cells would only affect the organism and not 7 points
    14·1 answer
  • Please help with the answer
    7·1 answer
  • Identify the example below that is NOT considered an evidence of evolution.
    7·1 answer
  • Can someone tell me what the heck this video is saying I'm so confused plz (PLZ ANSWER IF YOU KNOW)
    11·1 answer
  • NEED IT ASAP!! I WILL MARK A BRAILIEST
    12·1 answer
  • A population of wolves migrates north in search of food. As the wolves travel, they enter a region that
    13·1 answer
  • Ok last one, what has 61 neutrons and a mass number of 108.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!