1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
4 years ago
11

Question 1(Multiple Choice Worth 3 points)

Biology
1 answer:
igomit [66]4 years ago
7 0
The long period of time over a region is called climate
You might be interested in
Which of the following abiotic factors would likely affect humans directly?
alekssr [168]
One of the most abiotic factor that may affect humans directly is waster availability because with out water we can get dehydrated and die.
3 0
3 years ago
A living thing is surrounded by its
natima [27]
It is surrounded by it's environment.
7 0
4 years ago
Question 12 of 25<br> How are photosynthesis and cellular respiration related
Otrada [13]

Answer:

A) The products of photosynthesis are the reactants of cellular

respiration.

Explanation:

Photosynthesis converts carbon dioxide and water into oxygen and glucose, so that cellular respiration converts oxygen and glucose into water and carbon dioxide.

4 0
3 years ago
Read 2 more answers
What two body systems the immune system works with to keep you healthy
poizon [28]
The immune system, and the excretory system

(Honestly, all of them work to keep us 'healthy', but I believe these are the ones you're looking for)
6 0
3 years ago
Name at least three factors that influence the rate at which alcohol is absorbed
german
Amount of food in stomach when drinking, body weight, rate of consumption, strength of alcohol.
7 0
3 years ago
Other questions:
  • In pea plants, the gene for round seed (R) is dominant, and wrinkled seeds (r) are recessive. The endosperm of the pea is also e
    15·1 answer
  • A remarkable fact about cells is that _____.
    10·1 answer
  • Bacteria is the simplest of cells. One special feature of bacterial cells that helps it survive in hostile environment is its
    6·1 answer
  • Two hominid fossils are found in the same rock strata in caves about 10 kilometers apart in France. After radioactive dating, bo
    15·2 answers
  • The nurse finds that a patient has a blood pressure of 140/90 mm hg and has constricted bronchioles. which drug regimen will ens
    11·1 answer
  • A _____ is a site populated with people with erotic dispositions that they project on the space and each other, creating a syste
    9·1 answer
  • The movement of individuals into a population is called?
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • When making her coffee, Mrs. Jenkins likes to stir in some cream and sugar to give it a pleasant flavor. The ingredients, when c
    6·2 answers
  • As a result of the absence of clover, the hairstreak population in this location will MOST LIKELY
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!