1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mihalych1998 [28]
3 years ago
5

Which of the following is a good reason for why tobacco smoke is considered a carcinogen?

Biology
1 answer:
stepladder [879]3 years ago
3 0
A good reason for why tobacco smoke is considered a carcinogen is because it causes mutations leading to cancer. 
You might be interested in
What type of relationship exists between a bromeliad tree and a strawberry poison dart frog?
Pavel [41]

Answer:

<em><u>mutualism</u></em>

As Mackenzie told us, the mutualism between strawberry poison dart frogs and bromeliads is “evidence of the complexity that exists in the biological world and the interconnectedness of species.”

Explanation:

Hope it helps you..

Your welcome in advance..

(ㆁωㆁ)

3 0
3 years ago
PLEASE HELP ASAPPP!!
OLga [1]

Answer:

(a) frogs-flies

(b) birds-earthworms

(c) snakes-mouses

6 0
2 years ago
Read 2 more answers
Which of these organisms give birth to its young one alive? a. lizard b. man c. fish d. snake ​
jenyasd209 [6]

Answer:

b. man

Explanation:

lizards, fish, and snakes lay eggs while humans (and most mammals) give birth

3 0
3 years ago
Are plants able to do cellular respiration? Why or why not?
Maru [420]

Both plants and animals are able to do cellular respiration. Plants convert nutrients from the soil into usable energy.

This is the plant cellular respiration formula:

oxygen + glucose -> carbon dioxide + water + heat energy

Hope this helped! Let me know if there is anything I need to clarify or explain more in depth

8 0
4 years ago
Pulse-chase experiments and protein location
ExtremeBDS [4]

Answer:

The correct answer is option - phagocytosis.

Explanation:

The explained experiment is the pulse-chase experiment in this the cells that are involved are macrophages. Macrophages are the immunity cells that have a large number of the lysosomes for killing the pathogens enters in the cell brought into the cell through the process of phagocytosis.

Phagocytosis takes place with the help of the enzyme called hydrolytic enzyme that is synthesized in the endoplasmic reticulum and modified by Golgi and moves to the lysosome.

Thus, the correct answer is option - phagocytosis.

5 0
3 years ago
Other questions:
  • Do you think the world is flat?
    14·2 answers
  • Which is a function of the collecting ducts? which is a function of the collecting ducts? absorb electrolytes actively and water
    10·1 answer
  • Government-run health agencies are funded with taxpayers' dollars t/f
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • The endosymbiotic theory evolution states that organelles is eukaryotic cells are derived from bacteria which statement is the s
    7·1 answer
  • What would happen if photosynthesis could no longer occur on the planet?
    5·2 answers
  • Which of these is the BEST source of stem cells and minimizes the risk associated with stem cell transplantation?
    13·1 answer
  • What process lead to biological nitrogen fixation?
    7·1 answer
  • mollusks and arthropods get hit by water constantly so they built protective shell what can we hypothesize from this?
    11·1 answer
  • Which organelle controls when and what proteins are made? *
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!