1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sesenic [268]
4 years ago
11

Land with a few crops will always have less _______ than the same amount of land covered by a dense forest.

Biology
2 answers:
IceJOKER [234]4 years ago
8 0
I'm probably wrong but oxygen..?

Strike441 [17]4 years ago
8 0

Answer: the answer is biodiversity c:

You might be interested in
Which type of crop production is a large farm in the U.S. most likely to use?
Angelina_Jolie [31]
<span>D. Multiple cropping</span>
5 0
3 years ago
Nstead of defining life, scientists have decided to _____.
miss Akunina [59]
They have to describe the characteristics of life hope this helps.
4 0
3 years ago
make a list of all the non photosynthetic parts of a plant that need a supply of sucrose and amino acids​
STatiana [176]

Answer:

The non-photosynthetic parts of the plant include any parts that lack chlorophyll, such as the roots, woody stems, fruits, and seeds. These parts of the plant do not contain chlorophyll, and thus are unable to capture light energy from the Sun. They rely on photosynthetic parts of the plant, such as the leaves and parts of the stem to do photosynthesis. In vascular plants, the nutrients produced during photosynthesis are transported to non-photosynthetic parts of the plant through the phloem. Phloem is a vascular tissue designed to transport glucose and other nutrients produced during photosynthesis to parts of the plant that are non-photosynthetic, such as the roots.

Explanation:

brainliest plzzz

4 0
3 years ago
Why do waves move faster at higher temperatures and in a solid phase?
Mkey [24]

Answer:

B

Explanation:I took the test if u need help follow me

5 0
3 years ago
Read 2 more answers
A purple flower with an unkown genotype is crossed with a white flower. Determine the genotype of the purple flower if purple P
Tom [10]
Pp is the genotype because you know purple must have a gene of purple, which it says is dominant. If the white is recessive, the purple with dominate the white.
4 0
3 years ago
Other questions:
  • In chloroplasts, a proton gradient is established with a higher concentration of protons found in the ______ and a lower concent
    14·1 answer
  • Cartilage ground substance includes chondroitin and hyaluronic acid. <br> True or false
    14·1 answer
  • "what are hypertrophy and hyperplasia? how would these processes affect the appearance of the thyroid under the microscope? how
    9·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Earth formed when ____ caused small pieces of rock and metal to smash together and create the planet
    9·2 answers
  • What do all of the organ systems in a human form?
    7·2 answers
  • Which of the following blood vessels would have the lowest blood pressure?
    8·2 answers
  • Alice has type A blood and her husband mark has type B blood. Their first child, Amanda, has type O blood. Their second child ha
    8·1 answer
  • Most neighborhood streets are illuminated at night by streetlights. The streetlights are _____ and _____. Therefore, they are li
    8·1 answer
  • Which of the following statements about current theories on global warming is true? a. Scientists generally agree that global wa
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!