1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rodikova [14]
3 years ago
9

NEED IN LESS THEN 20 MINUTES Sound waves travel _____ their _____. A. outward from; source B. outward from; pressure C. inward t

oward; source D. inward toward; pressure
Biology
1 answer:
Brut [27]3 years ago
6 0
It’s most likely A if I’m not mistaken
You might be interested in
The body system that stimulates eating or drinking is the ________ system. The body system that stimulates eating or drinking is
lisov135 [29]

Answer: Nervous system.

Explanation:

Nervous system is the system in the body that consists of nerves,cells that coordinates action and sensory information and transmit nerve impulses between the body and the brain. In the body, Ghrelin is an hormone or chemical produced in the stomach. This stimulate hunger by acting on neurons in the hypothalamus which make the nerve cells that cause hunger to increase in their activity and reduce hunger inhibiting cells. The hypothalamus produce two proteins that cause hunger: neuropeptide Y (NPY) and agouti-related peptide (AGRP. This create a signals and it is send to the brain. The brain interprete it as hunger and send the signal to the hypothalamus which then influence eating behavior.

4 0
3 years ago
Identify and outline the process of condensation to form a disaccharide
alukav5142 [94]
In a condensation reaction, two molecules or parts thereof combine, releasing a small molecule. When this small molecule is water, it is known as a dehydration reaction<span>. Other possible lost molecules include hydrogen chloride, methanol, and acetic acid.</span>
5 0
3 years ago
If you have an open cut, what statement explains the precaution you should take regarding swimming, and why this is necessary?
FromTheMoon [43]

Answer:

You should wash your cut before and after swimming so that bacteria in the water can't infect the wound.

Let me know if its right <3

4 0
3 years ago
During which stage of a scientific investigation is data collected?
crimeas [40]

Answer: After the experiment in step 5

Explanation:

In a scientific investigation, first step is to formulate a question. Second step is to do background research. In third step after background research, a hypothesis is constructed. In order to test hypothesis, an experiment is designed and performed. In the fifth step, data is collected from the experiment and in the last step, conclusions are drawn from the collected data.

3 0
3 years ago
Read 2 more answers
Your favorite plant is growing very slowly, and you would like to find some way to increase its growth rate. Which of the follow
sasho [114]

Answer:

The correct answer is b. Nitrogen.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which are two characteristics of leisure​ travelers?
    8·1 answer
  • Which of the following issues is not an existing problem that biologists can help solve?
    5·1 answer
  • Which of the following disorders is by an individual who has the habit of eating to excess and then purging by vomiting?
    12·2 answers
  • HELPP ME NOW ASAPPP IMA GET DETETION
    7·2 answers
  • A student examines microscope slides containing different types of epithelial tissue. What is the MOST DIRECT way to differentia
    13·2 answers
  • Which of the following groups could be identified using the biological species concept? Select all that apply. Select all that a
    8·1 answer
  • What is a possible cost of habitat destruction?
    7·1 answer
  • What could happen if the brain stem were damage
    7·2 answers
  • Phel
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!