1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
3 years ago
5

What are two main types of posttranscriptional modifications that take place in the mrna of eukaryotes?

Biology
1 answer:
erastovalidia [21]3 years ago
4 0

Answer:

Addition of poly A tail and and addition of 5' cap

Explanation:

In eukaryotes, many post-transcriptional modification takes place like 5' capping, polyadenylation, and splicing. In 5' capping 7-methyl guanosine is added toward the 5' end of mRNA by the action of a enzyme called guanyl transferase. This cap protects mRNA from degradation.

In polyadenylation up to 250 adenosine nucleotides are added at the 3' end of the mRNA and it is called poly-A tail. Poly A polymerase is the enzyme that is responsible for polyadenylation.  

Therefore two main post transcription modifications are 5' capping and polyadenylation.

You might be interested in
What happens to any matter that is not used by consumers in a food chain?
kramer
Matter that is not used by consumers in the food chain become "detritus". Detritus, meaning debris or waste, are materials that are missed or uneaten by consumers. Because they do not participate in higher trophic levels, these materials are left to decompose. Detritus is often considered the "missing mass" when measuring the total mass in the food chain.
3 0
3 years ago
Read 2 more answers
What should James use to convert sunlight into electricity?
amm1812

Answer:

did you ever get the answer to this because i need it

Explanation:

7 0
3 years ago
Read 2 more answers
Please help I need to turn in this paper asap the paper
Nadya [2.5K]

Atoms gain electrons to form anions.

Atoms lose electrons to form cations.

Back in middle school, my chemistry teacher taught me a good way to remember whether an ion was a cation or an anion. When an atom loses an electron, it becomes positive, and when an atom gains an electron, it becomes negative.

Cation sort of sounds like “cat,” which is positive (Yay! Cats!).

Anions, on the other hand, sounds like “onion,” which is negative (Ew! Onions!).

There’s other ways of memorizing it, but this way was the easiest for me.

-T.B.

3 0
3 years ago
Blacks have been found to score lower on tests of verbal aptitude when tested by whites than when tested by blacks. This best il
Paladinen [302]

Answer:

The correct answer is - stereotype threat.

Explanation:

Stereotype threat is a conditional or temporally predicting in which individuals are likely to feel or experience themselves to be a risk of conforming to stereotype about their social groups.

In this case blacks, academic performance shows the impact of stereotype threat which is allegedly a key factor to racial for long period in academic performance.

Thus, the correct answer is - stereotype threat.

5 0
3 years ago
drugs that stimulate alpha receptors, causing constriction of peripheral vessels, are group of answer choices autonomic blocking
Dima020 [189]

The Parasympathomimetic<u> </u>branch of the autonomic nervous system is activated by the family of pharmacological drugs known as parasympathomimetics. Agonists are two types of medicines.

The main neurotransmitter of the parasympathetic nervous system, acetylcholine (ACh), is mimicked or modified by parasympathomimetic medications to have their desired effects. Depending on whether they are direct or indirect agonists of acetylcholine ACh, parasympathomimetic drugs fall into one of two basic types. While indirect agonists raise synaptic levels of Acetylcholine ACh by decreasing the enzyme acetylcholinesterase, direct agonists directly bind and activate muscarinic ACh receptors.

Providers of healthcare should keep an eye on patients receiving parasympathomimetic drugs to make sure the treatment has the desired therapeutic impact. Parasympathetic Patients must be continuously monitored by the provider for any potential side effects. Due to the overstimulation of acetylcholine receptors, an overdose may cause a potentially fatal cholinergic crisis. There are several different formulations of parasympathomimetic drugs available to treat acetylcholine. To cure glaucoma and induce miosis during surgical operations, for instance, topical formulations of carbachol and pilocarpine are available for ocular use. Neostigmine is administered parenterally to treat paralytic ileus and act as a bladder agonist.

Learn more about agonist

brainly.com/question/14286421

#SPJ4

3 0
1 year ago
Other questions:
  • What is the best explanation for why a cell might shrivel?
    8·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A cell may die if...
    11·2 answers
  • When you are frightened by something, what part of the brain directs your body to react by making your heart beat faster and inc
    5·1 answer
  • Vhat is the function of the cell wall in a plant cell?
    14·2 answers
  • 35. The activities of life, including chemical reactions, require __________.
    10·2 answers
  • What happens when light goes through a prism
    12·1 answer
  • Do it in a visual learner's point of view​
    11·1 answer
  • What is fermentation
    8·1 answer
  • Why do we use models in our everyday lives especially for the weather?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!