1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
3 years ago
8

What is the correct sequence of events in the field of molecular biology?

Biology
1 answer:
tatiyna3 years ago
5 0

Answer: In the field of molecular biology the correct sequence of events are as follows:

1. Gregor Mendel proves the Laws of Inheritance in 1865.

2. Friedrich Miescher conducted experiments to identify nuclein as the building blocks of life in 1869.

3. James Watson and Francis Crick presented a model of DNA in 1953.

4. Frederick Sanger developed a method for sequencing DNA in 1977.

You might be interested in
How does Thermally Sensitive Liposomes Work?
Virty [35]

Answer:

Thermosensitive liposomes (TSL) are promising tools used to deliver drugs to targeted region when local hyperthermia is applied (∼40–42°C) which triggers the membrane phase transformation from a solid gel-like state to a highly permeable liquid state. Selective lipid components have been used to in TSL formulations to increase plasma stability before hyperthermia and speed drug release rate after. Two generations of TSL technology have been developed. The traditional thermal sensitive liposomes (TTSL) have utilized DPPC and DSPC as a combination. The second generation, lysolipid thermally sensitive liposomes (LTSL) technology, has been developed with incorporation of lysolipids that form stabilized defects at phase transition temperature. LTSL maintains certain favorable attributes:

High percentage of lysolipids incorporation;

Minimum leakage for therapeutical drugs encapsulation;

Ultrafast drug release upon heating (3.5 times enhanced compared to TTSL). For example, ThermoDox, a commonly used LTSL drug for cancer, has been reported to release 100% of the encapsulated doxorubicin within 30s;

First and most successful formulation for intravascular drug release.

Explanation:

https://www.creative-biostructure.com/Lysolipid-Thermally-Sensitive-Liposomes-Production-612.htm

7 0
3 years ago
Beekeepers and scientists are puzzled and troubled by a decline in bee populations around the world. what would you predict as a
harkovskaia [24]
The most likely consequence of the widespread lack of bees is loss or reduction of food. Majority of food depends on pollination and bees are major pollinators in the ecosystem, playing an essential role in food production among different type of plants. Bee’s declining population is mostly associated to excessive use of pesticides or toxicants in industrial agriculture as well as presence of different parasites or pathogens and even climate change.
8 0
3 years ago
Which of these is the direct result of an error in the transcription of a DNA nucleotide?
Inga [223]
What are the options
7 0
3 years ago
Read 2 more answers
The majority of marine organisms are found in coastal regions, rather than the open
mezya [45]

Answer:

Ocean currents bring nutrient-rich water into coastal regions.

Explanation:

About 70 percent of our planet is covered by water. The earth has been declared a "blue planet" because it looks blue from space. About 96 percent of this water is the sea or salt water, made up of the ocean that covers the Earth.

Within these oceans, there are many different types of habitats or environments inhabited by plants and animals, from the freezing of polar ice to tropical coral reefs. Most marine life is found in coastal habitats.

7 0
3 years ago
Question in the photo
Arisa [49]

Answer:

C

Explanation:

From reading what the process is, I think the answer should be C. The definition always says that you get energy from a chemical reaction and the products are CO2 and water. That can only mean that you have a hydrocarbon burning.

Chemically it looks like

C6H12O6  +  6O2 ====> 6CO2 + 6H20

5 0
2 years ago
Other questions:
  • What is the role of the central nervous system in this model
    7·1 answer
  • Bacteria from the soil absorb nitrogen from the air and convert it into ammonium. This is an example of _____.
    7·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Need help on this question.
    15·1 answer
  • A scientist observes a previously unknown species. It is multicellular, and has specialized sense organs. Based on the diagram o
    6·2 answers
  • The amino acids coded by specific condons
    7·1 answer
  • 1. Which of the following best explains how Earth’s atmosphere protects life on the planet?
    15·1 answer
  • 14. What does that leave as the source for the energy that is now in the food molecule?
    12·1 answer
  • PLEASE HELP!!! I. NEED HELP IN BIOLOGY FAST!! EXPLAIN!!
    13·2 answers
  • 1. What class of biological molecules does sugars belong to?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!