1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ierofanga [76]
4 years ago
8

What characteristic describes both amoebas and bacteria

Biology
1 answer:
ruslelena [56]4 years ago
3 0
They are both made of one cell called Unicellular. Hope this helps!
You might be interested in
The Fugate family, also known as the "Blue People of Kentucky" have a condition known as methemoglobinemia which prevents hemogl
Kobotan [32]
The answer is C. <span>Individuals with higher levels of methemoglobin have symptoms that prevent them from reproducing.</span>
6 0
3 years ago
Read 2 more answers
Organisms require energy to maintain a proper internal order. If the orderly internal environment of the cell is not maintained,
slamgirl [31]

Answer:

entropy

Explanation:

4 0
3 years ago
Which of the following functions is the nucleus responsible for? (Choose all that apply)
statuscvo [17]
<h2><u>Answer:</u></h2>

<u><em>The nucleus has three major functions: </em></u>

  1. Store the inherited material of the cell (DNA)
  2. Coordinates the activity of the cells ( i.e. growth, intermediate metabolism, protein synthesis and cell division/ reproduction).
  3. It maintains gene safety and monitors the functions of the whole cell through the regulation of genetic expression.

7 0
3 years ago
What is one property of a molecule that determines whether it will pass through a selectively permeable membrane?
sdas [7]
Polarity, or whether a molecule is charged, is a property of a molecule that determines whether it will pass through a membrane
6 0
4 years ago
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Other questions:
  • Shivering warms the body by causing involuntary muscle contractions, which two body systems are working together to help you mai
    15·1 answer
  • Which is an example of radiation?
    5·2 answers
  • Two-month-old roderick lives in a home with parents who both smoke cigarettes. he has a mild respiratory infection and sleeps on
    12·1 answer
  • Organs make up the ________ system of the frog
    14·1 answer
  • What is the relationship between these three structures
    11·1 answer
  • You and your lab partner are classifying the rocks found in the sample shown.
    12·2 answers
  • Double-stranded rna genomes can be found
    10·1 answer
  • Where does the water goes to first in a plant
    9·2 answers
  • Producers, consumers, and decomposers play important roles in the environment. Are there any organisms that would not fall into
    11·1 answer
  • Which level represents 0.1% of the energy aquired by the producers?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!