1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
3 years ago
12

What do high energy particles that reach our atmosphere create ? please help quickly !

Biology
1 answer:
kap26 [50]3 years ago
4 0

Answer:

Cosmic - Rays

Explanation:

You might be interested in
Can y’all send many as many answers as possible ASAP please thanks it’s for a crossword puzzle
Nady [450]
I know that 16 is eye
8 0
4 years ago
Receptors are typically specialized to react to specific stimulation by initiating a ______ change.
DIA [1.3K]
Receptors are typically specialized to react to specific stimulation by initiating a chemical or biochemical (in the case of biochemistry) change. In the field of pharmacology or biochemistry, receptors are usually a protein molecules and the change it undergoes are usually specific to the type of stimuli or signal it is responding to.
7 0
4 years ago
Which of the layers of the epidermis is found only in thick skin?
horsena [70]

Answer:

stratum spinosum

Explanation:

The stratum spinosum is the thickest layer of the epidermis which lies just above the basal layer. The stratum spinosum consists of basal cells that have matured into squamous cells, also known as keratinocytes.

6 0
3 years ago
Plant and animal cells make exact copies through the process of
yawa3891 [41]
A) mitosis it makes a exact coppie
6 0
3 years ago
Read 2 more answers
Who studied the role of RNA in protein synthesis, specifically in the bacteria E. coli.
atroni [7]
Nirenberg and Matthaei
8 0
3 years ago
Other questions:
  • Three characteristics of life that archaea bacteria have
    9·1 answer
  • A viral infection of the liver is called _____.<br> dysentery<br> polio<br> mumps<br> hepatitis
    9·2 answers
  • Which of the following is NOT a benefit of shared sleeping?
    14·1 answer
  • Substance that accelerates any chemicl reaction but is not consumed in the action
    15·1 answer
  • If you want to know the damage that an earthquake of a 7.0 magnitude can do, refer to a _____.
    14·2 answers
  • Which of the following processes is directly affected by the cardiovascular system? hair growth muscle strength healing of cuts
    15·2 answers
  • Rna primers must be present on which strand during dna synthesis?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How can genes be turned on and off?
    7·1 answer
  • 1. Which letter is the path of the Sun on December 21st?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!