3 years ago

An enzyme is a form of what

Biology

2 answers:

dezoksy [38]3 years ago

7 0

Answer:

Proteins.

Explanation:

Proteins are made of the polymers of the amino acids that are linked together through the peptide bond. The proteins are the important biomolecules of the living organism.

The enzymes are made of the proteins. Each enzymes shows the important specific sequence of the amino acids. These enzymes are used in the metabolic reaction for the efficiency of the reaction and increases the rate of a reaction.

Thus, the answer is proteins.

marusya05 [52]3 years ago

4 0

What an enzyne is a form of is a Protein.

You might be interested in

HELP plzzzzzzzzzzzzzzzzzz this is apart of a TEST PLZ HELP

anastassius [24]

Answer: I believe it is organ system

Explanation:

7 0

3 years ago

Read 2 more answers

The effects of the sympathetic nervous system (sns) are divergent, meaning that a single stimulus can have an effect on a large

enot [183]

The sympathetic ganglia spreads the stimulus to all postganglionic sympathetic neurons.

4 0

4 years ago

The neurology consult report includes the following statement: "Client’s diet is notable for moderate amounts of aspartame and n

astraxan [27]

Answer:

- Aspartame is an artificial sweetner that replaces sugar in a variety of food products.

- Glutamate is a known food additive monosodium glutamate (MSG) used as a flavor enhancer commonly found in American-style Chinese food, canned soups and vegetables, and processed meats.

3 0

3 years ago

[BWS.03]Scientific laws are

melomori [17]

Answer:

scientific laws are descriptions of specific relationships under given conditions in the natural world

3 0

2 years ago

Pls, I need help with this! Biology Thank you :)

topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0

3 years ago