It is false that Qualitative research generally uses numbers to represent research data. Qualitative research is more on descriptions and meanings.Quantitative research is the word for this description.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
(D) Both perform photosynthesis is the observation that led researchers to propose that chloroplasts evolved from cyanobacteria.
Chloroplasts is the area where photosynthesis takes place. It is a green organelle in a plant cell. Pigments called the chloros in a chlorophyll are needed for the photosynthesis.
Cyanobacteria or blue-gree algae contains a blue photosynthetic pigment and a chlorophyll for photosynthesis.
Answer:
Lipids
If i were to guess, without any answer choices, I would say that we get out energy from carbohydrates, and we store energy in lipids, so Lipids (being long chains) might have the most energy.
Explanation:
Please tell me if this is wrong, I did not have much to work with without any answer choices, and this was very broad. :)
Some common adaptation in organisms would be:
Behavioral adaptation.
Biological adaptation.
Natural selection.
