1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirza4 [7]
3 years ago
8

Which behavior in a client with schizophrenia demonstrates the client's cognitive inability to appropriately process data from e

xternal stimuli?
Biology
1 answer:
zlopas [31]3 years ago
3 0
The answer would be d<span>elusional beliefs
</span>
Schizophrenia is caused by high amount of dopamine inside the brain. It can cause the patient to percept something when there is no external stimulus taken(it different with the illusion where the external stimulus exists but perceived wrongly).
They also couldn't process the external stimuli, resulting<span> in delusional beliefs. 
</span>

You might be interested in
The dyeing method used to produce a green and white plaid pattern for 100% cotton broadcloth is ______.
Diano4ka-milaya [45]
Yarn dyeing would be your answer
3 0
2 years ago
Wich best describes traditional classification?
Step2247 [10]
It is based on shared characteristics 
5 0
2 years ago
Read 2 more answers
If someone sitting at the other end of a restaurant smokes a cigarette, you may still breathe some in some of the smoke. The mov
34kurt

Answer:

C.facilitated diffusion

Explanation:

Because it have some chemicals did you breathe from the person who using cigarettes.

8 0
3 years ago
Two students are planning an experiment that will test how planaria (aquatic flatworms) respond to different environments. They
Delicious77 [7]

Student 1’s methods would be more accurate, because the student would control more factors. Only one variable at a time (either temperature or acidity) would be tested on each group of worms. On the other hand, Student 2 is testing both factors on all the worms, which could make the results unclear.


4 0
2 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Smog complex is: an atmospheric condition during which a warm layer of air stalls above a cool layer the precipitation of acidic
    14·1 answer
  • In what ways do natural events affect the envoronment? Write down at least 2 and why. Do you believe these events affect the env
    7·1 answer
  • During digestion, larger nutrients are broken into smaller units, including ____.
    10·1 answer
  • ¿Qué es la transcripción inversa? ¿En qué proceso participa?
    15·1 answer
  • If two organisms are in the same phylum, which other classification category must they also share? A.class B.order C.kingdom
    7·2 answers
  • Our body generates opiate-like neurotransmitters which can reduce pain. They are called
    10·1 answer
  • If solution A has more solute particles dissolved in it than solution B, then solution A is _____.
    6·1 answer
  • 2. Why is it important to have diversity within a population?
    12·1 answer
  • The gamete that contains genes contributed only by the mother is:.
    10·1 answer
  • The outer boundary of living protoplasm in a plant cell is a Group of answer choices vacuolar membrane. cell membrane. primary c
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!