It should be
AGATACCATGGTTACCCGGTTCCA
For biotic, I put; Flowers, Dogs, Insects, Bacteria, Protists
<span>For abiotic, I put; Water, Couch, Bed, Laptop, Clothes</span>
I think this depends on you because it your choice for yourself but I'll just state some information or facts about this career.
- The field is a specialization in biomedical engineering that can take four to eight years to master.
- Genetic engineering has been applied in numerous fields including research, medicine, industrial biotechnology and agriculture. In research GMOs are used to study gene function and expression through loss of function, gain of function, tracking and expression experiments.
- Success rates are incredibly low; on average, less than 10% of embryos survive to birth and a smaller percentage of those born survive to adulthood.
- The field of genetics allows you to work in medical as well as scientific research.
- To become a genetic engineering research scientist, you need a doctoral degree in a biological science.
- Genetic engineers can earn anywhere from $44,320 to $139,440 a year.
Hope this helps and if you could mark me as brainliest. Thanks!
