1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
skad [1K]
4 years ago
9

The hottest recorded temperature in history occurred in Death Valley, California, July 10, 1913. The temperature was recorded at

134°F. Convert this temperature to Celsius and Kelvin.
Biology
1 answer:
marusya05 [52]4 years ago
3 0

Answer:

134 degrees F to degrees Celsius is 56.667

134 degrees F to degrees Kelvin is 329.817

Explanation:

Formula for F to C= (134°F − 32) × 5/9 = 56.667°C

Formula for F to K= (134°F − 32) × 5/9 + 273.15 = 329.817K

You might be interested in
What causes the isopods to move to a specific area?
Ilya [14]

Answer:

Effects on biodiversity at different scales, geographical regions, and environments. Mostly humidity and temperature.

Explanation:

Isopod distribution is tightly connected to available habitats and habitat features at a fine spatial scale, even though different species may exhibit a variety of responses

8 0
3 years ago
Environmental impact of stem cells
Nana76 [90]

embryonic stem cells could serve as a model to evaluate the physiological effects of environmental pollutants efficiently and cost-effectively.

6 0
3 years ago
Read 2 more answers
Homeostasis is defined as A. the variety of foods that an organism takes in for energy and survival. B. the control of an organi
almond37 [142]

Answer:

D. the dynamic regulation of an organism's internal environment to maintain conditions suitable for survival.

Explanation:

8 0
3 years ago
Who coined the term “Jazz Age”? A. Ernest Hemingway B. F. Scott Fitzgerald C. Sinclair Lewis D. Langston Hughes E. Duke Ellingto
Rufina [12.5K]

Scott Fitzgerald so the answer is B

3 0
3 years ago
Read 2 more answers
Explain how the structure of a cellulose molecule relates to the molecules function please?
S_A_V [24]
The molecule is formed from glucose, which fits together nicely and becomes sturdy. It relates to the function of the cellulose model because it aids in strength and structural support.
5 0
4 years ago
Read 2 more answers
Other questions:
  • How do histones and nucleosomes affect DNA?
    11·1 answer
  • How will the cardiac output change if you double the heart rate but reduce the stroke volume by one-half? how will the cardiac o
    11·1 answer
  • 3. Which of the following is a characteristic that could be applied to both living and nonliving things? (1 point)
    11·1 answer
  • A student investigating the importance of wavelengths above and below the visible spectrum for photosynthesis sets up an experim
    9·1 answer
  • The replica fossil you just created models the actual formation of fossils on Earth. In your replica, what do the clay and the p
    7·1 answer
  • What is the scientific name for a living thing
    14·2 answers
  • Why can many ecosystems exist in one biome?
    7·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • What are the Advantages of gmo (both of animals and plants)
    6·1 answer
  • Which statement accurately describes a relationship between two parts of the universe?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!