1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
6

In what way are herbivores and carnivores alike

Biology
1 answer:
Vikki [24]3 years ago
6 0
They both do not produce there own food they consume it in the matter
You might be interested in
One of the first scientists of the Renaissance to advance taxonomy through firsthand observations was _____.
Fed [463]
Alright bud the best answer to this question would be that one of the first scientists of the Renaissance to advance taxonomy through first hand observations was Cordus 
6 0
3 years ago
Which of the following is a limited resource?
stellarik [79]
I'm pretty sure that it's natural gas.
6 0
3 years ago
Read 2 more answers
How might it be possible for a child to show a trait that neither of the parents showed?​
e-lub [12.9K]

A person can only show a recessive trait if both of their parents carried at least one copy of each of the recessive allele. The parents do not need to show the trait, as one copy is not enough to reveal it, but they must both carry it.

Hope this helped!

5 0
2 years ago
In order for sharks to maintain a concentration balance with it’s environment, a
Ksivusya [100]

Answer:

B. retain its urine in it’s blood stream

Explanation:

Sharks are cartilaginous fishes that lives in the ocean. Oceans are always salty, hence organisms need to maintain a salt-water balance between their internal and external environment because of osmosis. Sharks are able to maintain this by ensuring that the amount of solutes in their internal environment is as much as that in their external environment.

Sharks retain a chemical contained in urine called UREA in their bloodstream to counter the osmotic effect of the salt concentration in the waters they live. This helps them maintain a concentration balance with their environment.

4 0
2 years ago
Mitosis produces which cell type?<br> haploid<br> diploid<br> chromosome<br> gamete
erastovalidia [21]

Answer:

b, diploid.

Explanation:

Mitosis produces two diploid somatic cells, genetically identical to each other and the parent cell.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Tundra means “treeless land.” <br> True or False
    14·2 answers
  • The outermost layer of earth is called the mantle t or f
    5·2 answers
  • [I need help -FAST-!! Please help!!]
    10·1 answer
  • Malcolm is studying alone in his room late at night when he hears a loud noise downstairs. His heartbeat increases significantly
    10·1 answer
  • The Punnett square shows the results when two parent dogs are crossed. L represents the allele for a long tail, and l represents
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Can someone please describe a plant's circulatory system or how it works?
    12·1 answer
  • 2 differences between<br>monocotyledondus and dicotyledonas plants<br>​
    7·1 answer
  • Humans and dogs evolved from a common ancestor. Which pieces of evidence would support this? Check all that apply. Both of their
    14·2 answers
  • What best summarizes the differences between ancient and modern horses?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!