1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
3 years ago
6

Which phrase describes elevation

Biology
1 answer:
Stolb23 [73]3 years ago
8 0
What phrase are u talking about ?
You might be interested in
During which phase do the chromosomes make copies of themselves so that there are two of each one?
SashulF [63]

Answer:

The beginning and majority of the time is known as Interphase. Interphase is 80% of the total cycle and is where the cell does most of the work in replicating organelles, chromosomes, and preparing to undergo Mitosis which is the actual splitting process where one cell becomes two. During Interphase there are 3 major steps, G1, S, and the G2 phase.

Explanation:

4 0
2 years ago
Fish rely on coral for
vampirchik [111]
They use them as food and habitats.
7 0
3 years ago
Read 2 more answers
Which is the best example of competition in a forest ecosystem?
Mrac [35]
D) Blue Jays and Finches nest in the same Oak Trees.

Explanation:

This is an example of competition because two species are for the same thing, in this case, oak trees to nest in.
3 0
3 years ago
How does water pollution seem to be affecting diversity in some streams
Alex73 [517]

Answer:

because somethings could go out into the ocean and harm sea animals like turtles some get stuck in plastic and some die because of water poeple throw away and if that continued we may make all the sea life die because of that

3 0
2 years ago
What is the largest flower in the world?
kykrilka [37]

Answer:

<u>Rafflesia arnoldii</u>

Explanation:

The flower with the world's largest bloom is the Rafflesia arnoldii. This rare flower is found in the rainforests of Indonesia. It can grow to be 3 feet across and weigh up to 15 pounds! It is a parasitic plant, with no visible leaves, roots, or stem.

8 0
3 years ago
Other questions:
  • A nurse is assigned to work with a client who has a disability. the nurse believes that all people with disabilities have a poor
    10·1 answer
  • True or false
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which is an example of commensalism in the tropical rainforest?
    7·2 answers
  • Any ideas of the answers?
    9·1 answer
  • A disease has wiped out the crab population. How will this affect the flat winkle population?
    11·2 answers
  • PLEASE HELP!! ASAP!!Inherited traits are governed by-
    15·1 answer
  • A farmer uses genetic engineering to inject dairy cows with a genetically altered hormone (GAH) to result in the production of m
    13·1 answer
  • A tall pea plant results from a dominant tall allele while the short phenotype results from two recessive alleles. What is the f
    6·2 answers
  • The cell membrane is said to be semipermeable because
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!