Electromagnetic waves with a long wavelength occur at a frequency and are energetic.

1 answer:

3 0

As the energy of a wave length increases the length gets shorter.A wave with low frequency would have relatively low energy and a long wavelength.

You might be interested in

how does the skeletal system help the body maintain homeostasis? if it doesn't function correctly how does it affect the body?

QveST [7]

Answer:

Meanwhile, your bones are busy making new blood cells. Working together, these systems maintain internal stability and balance, otherwise known as homeostasis. Disease in one body system can disrupt homeostasis and cause trouble in other body systems.

Explanation:

please mark me as brainlist

Thank you

4 0

3 years ago

Why does the texture of an igneous rock generally tell you more about how it formed than about its mineral composition?

7nadin3 [17]

Answer:

The texture of an igneous rock is dependent on the rate of cooling of the melt: slow cooling allows large crystals to form, fast cooling yields small crystals.In addition to texture, igneous rocks may are classified according to their chemical composition.

Explanation:

4 0

3 years ago

Exocytosis is the process by which vesicles in the cytoplasm fuse with the cell membrane, releasing their contents into the cell

user100 [1]

I think it is (A) I hope this helps. :)

7 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Most respiration occurs in oragnelles called

frozen [14]

Answer:

mitochondrion

Explanation:

8 0

3 years ago

Electromagnetic waves with a long wavelength occur at a ________ frequency and are ________ energetic.

Electromagnetic waves with a long wavelength occur at a frequency and are energetic.