1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
3 years ago
10

What happens to the population density and competition if the birth rate decreases?

Biology
2 answers:
Yanka [14]3 years ago
5 0
What happens to the population density and competition if the birth rate decreases? 
The birth rate would increase is the population density competition increased. 
Hope I helped. 

Ilia_Sergeevich [38]3 years ago
5 0

Answer:

The population density and the competition decreases in the population.

Explanation:

Population density may be defined as the number of individuals people living in an area per square kilometer. Birth rate is the umber of individuals born per 1000 in a year.

Population density is directly population to the birth rate. Since, the birth rate decreases the number of individual decrease and population density will decrease. Competition is high in a population if the number of individuals are large. Here, the birth rate decreases so the competition will also decrease as the number of individuals will decrease in the population.

Thus, competition and population density decreases if birth rate decreases.

You might be interested in
All of the genetic material in an organism. a.) genome b.) stem cell c.)GMO
OLEGan [10]

Answer:

B

Explanation:

5 0
3 years ago
Amendment X The powers not delegated to the United States by the Constitution, nor prohibited by it to the States, are reserved
scoray [572]
The answer is B. 

Good day sir
3 0
3 years ago
Read 2 more answers
Why do we sometimes say that we have 23 pairs of chromosomes? Where do the halves of the pair come from?
deff fn [24]
Hhhhhh hhhhh hhhh mmmmhhh
3 0
3 years ago
Read 2 more answers
The autonomic nervous system controls all __________ responses of the body.
Mumz [18]

A. unconscious

It's A because it controls the involuntary actions like our heart beat or breathing. The actions we aren't consistently remembering to do.  

4 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
2 years ago
Other questions:
  • What biomolecule determines whether an individual inherits the inability to produce the enzyme needed to break down the amino ac
    15·1 answer
  • The innermost meninx that protects the brain and spinal cord is the _________.
    8·1 answer
  • If you are growing a culture of bacteria (150ml) in the incubator, (a) what size flask should you use, and (b) should you cap th
    15·1 answer
  • When farmers experiment with selecting and breeding individual species with the traits they want them to have, this is an exampl
    8·1 answer
  • One of the following results when rocks that are under stress from the internal earth processes that produce continents and ocea
    9·2 answers
  • EASY POINTS IF YOU ANSWER THEM CORRECTLY!! the questions are easy and I don't feel like doing them but plz answer correctly befo
    13·1 answer
  • Bottom-oriented fish have large, broad pectoral fins and depressed( flattened top-to-bottom) body shapes. Explain how these adap
    9·1 answer
  • What will a heterozygote show when two alleles are codominant?
    7·2 answers
  • Which of the following is true about a trait? *
    14·1 answer
  • An atom charged -3 has atomic number 23 and atomic mass 32 what is the number of electrons of this atom
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!