1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marizza181 [45]
4 years ago
13

Look at the picture Below Please Help!

Biology
1 answer:
NikAS [45]4 years ago
7 0
More trees or seeds for trees
You might be interested in
From a cross between a short haired guinea pig (hh) and a long haired guinea gig (HH), what would be the possible phenotypes of
densk [106]
     H     H
h | Hh | Hh |
h | Hh | Hh |


I tried to make a Punnet square~ x3
There is no possible way the offspring will have short hair.
Hope this helps!~ :3
4 0
3 years ago
Vegetative plant organs are the root, stem, and leaf. Each organ has a specific
liberstina [14]

The stem is the life of the plant, as it transports the water and nutrients between the roots and the leaves.

6 0
3 years ago
Which of the following would not be among the most important characteristics of chemicals in determining their environmental ris
lozanna [386]

Answer:

C

Explanation: all the others are considered very important in determining a substance so they would also be important for the level of environmental risk

3 0
4 years ago
Explain three places where energy is transferred in the components of the ecosystem in a kelp forest
nataly862011 [7]

ANSWER:

1. Sun

2. Water

3. Soil

7 0
3 years ago
Deep-oceanic trenches are formed a subduction
miskamm [114]

Answer:

Convergent

Explanation:

In particular, ocean trenches are a feature of convergent plate boundaries, where two or more tectonic plates meet. At many convergent plate boundaries, dense lithosphere melts or slides beneath less-dense lithosphere in a process called subduction, creating a trench.

7 0
3 years ago
Other questions:
  • The nurse recognizes that which patient condition is associated with a sweat chloride level of 75 mmol/l and chromosome 7 mutati
    15·1 answer
  • Compared to insulators, metals are better conductors of electricity because metals contain more free
    6·2 answers
  • Based upon the specific health effects described above, mercury would be best classified as a ________.
    13·1 answer
  • What is meant by the term insulin resistance? Blood glucose is high, and the kidneys cannot reabsorb enough glucose, which can b
    14·1 answer
  • A normal sequence of DNA bases in a single human skin cell is CATGGC.
    10·1 answer
  • When matter is broken down physically by wind or chemically by salt water, what is<br> this known as
    12·1 answer
  • Categorize Different Foods Categorize the food items below by selecting which macromolecule they are known to contain. apple ste
    12·2 answers
  • Which organisms are typically found at the beginning of aquatic food chains?
    9·2 answers
  • Does the stomach only does chemical digestion to break down food?
    10·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!