1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RUDIKE [14]
3 years ago
7

The capital of Srilanka?

Biology
2 answers:
vesna_86 [32]3 years ago
8 0
<span>Capitals: </span><span>Sri Jayawardenepura Kotte, <span>Colombo</span></span>
Romashka [77]3 years ago
5 0
The capital of Srilanka is Colombo or Sri Jaya Wardene Pure Kothe
You might be interested in
"the ________ or frontal plane divides the body into anterior and posterior portions"
kipiarov [429]
I believe it is the sagittal plane
6 0
3 years ago
Explain what sets convection currents into motion.
mote1985 [20]
All that is needed is a warmer, lighter fluid below a cooler, heavier one.

Since warm water is lighter, it will rise, and will cool from the top will flow down to replace it, this makes it go in motion
5 0
3 years ago
The scientific name of a living thing is made up of its genus and _____ names.
Elanso [62]
Species.
The scientific name is in the form genus species.
8 0
3 years ago
Read 2 more answers
In a nuclear reactor, when the control rods are lowered between the fuel rods, they ______ the reaction
Jet001 [13]

Answer:

i believe its slow

Explanation:

3 0
3 years ago
What are the appendages of a sea anenome called?
Natasha2012 [34]
They have their tentacles which house cells called<span> cnidocytes.</span>
6 0
3 years ago
Other questions:
  • Which of the following performs the phosphorus cycle A) Autotrophs C) Carnivore B)Heterotrophs D) Herbivore
    12·1 answer
  • true or false during the process of osmosis when the concentration of water inside the cell is greater than outside of the cell
    9·1 answer
  • In pea plants, smooth seed texture is dominant over wrinkled seed texture. A gardener has a pea plant that produces smooth seeds
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Air can be disinfected using __________
    15·1 answer
  • 6. The smallest idea can grow to the point that it will define you or destroy you. Explain what this
    7·1 answer
  • you have selected the following prediction to test: Previously thinned forests will have higher tree survival than adjacent fore
    15·1 answer
  • ​which substance is known to be produced by small intestinal bacteria?
    6·1 answer
  • The table below shows the use of some energy production methods over time.
    5·1 answer
  • Hii! i’ll give brainliest pls help
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!