1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FromTheMoon [43]
4 years ago
14

How many grams are there in 2.5 kilograms

Mathematics
1 answer:
Tresset [83]4 years ago
5 0

2.5 kg * 1000g/1 kg = 2500g

Answer:  There are 2500 g in 2.5 kilograms

You might be interested in
Write 6(x – 5)4 + 4(x – 5)2 + 6 = 0 in the form of a quadratic by using substitution.
pogonyaev

We are given the equation:

6(x-5)^{4}+4(x-5)^{2}+6=0..........(1)

Now we have to write it in quadratic form using substitution.

The general form of quadratic equation is given by:

ax^{2}+bx+c=0

So let us say

(x-5)^{2}=u.......(2)

Plugging the value of (x-5)² from equation (2) in (1),

6u^{2}+4u+6=0

Answer : Option B. 6u^{2}+4u+6=0


6 0
3 years ago
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
Do you go to the movies at least twice a week?
neonofarm [45]

Answer:

0.438

Step-by-step explanation:

8 0
3 years ago
What is the easiest way to find a geometric mean?
zubka84 [21]
GM= ( II i = 1 xi) 1/N
for example, {3,4,2,6}.
GM = (3*4*2*6) 1/4
GM = 144*1/4
GM ~ 3.464
6 0
4 years ago
Martina and Charlotte are sharing a pizza.The pizza is cut into eight pieces.Martina ate a quarter of the pizza.Charlotte are 3
mr Goodwill [35]
Three pieces are left.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Can anyone help me please
    14·1 answer
  • Find the final balance in an account with $820 invested at 4% annual simple interest for three years
    13·2 answers
  • How to find slope of parall lines
    12·2 answers
  • Which of the following is a perfect square?<br> A. 279<br> B. 154<br> C. 169<br> D. 115
    9·1 answer
  • a number 84 is divided into two parts. if the difference between half of the first part and one-third of the second part is 12,
    7·1 answer
  • Find the volume of a right rectangular prism if the dimensions of the base are 4 centimeters by 9 centimeters and the height is
    12·2 answers
  • An aircraft (at Z) is spotted by two observers (at X and Y) who are L = 1950 feet
    14·1 answer
  • A pair of AirPods cost $120 at the store. A
    14·2 answers
  • Please help me solve for x
    11·1 answer
  • Ann made a scale drawing of a theater. The scale she used was 1 inch : 7 feet. The stage is
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!