1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kakasveta [241]
3 years ago
6

I will mark you as brainliest 25 points!!!!!

Biology
1 answer:
Ahat [919]3 years ago
5 0

Answer:

I have no clue what your asking

Explanation:

Sorry but I need more context

You might be interested in
22)
eimsori [14]
Fat is converted to carbon dioxide and water. You exhale the carbon dioxide and the water mixes into your circulation until it's lost as urine or sweat
7 0
3 years ago
Read 2 more answers
The lumper potatoes that were grown in Ireland during the 1800s were essentially clones of one another. They all had the same ge
Verdich [7]

Answer:

some potatoes would be more likely to have genetic resistance to the disease and survive.

4 0
3 years ago
Which part of mushroom do you see above the ground
Dahasolnce [82]
The part you can see above ground is called the Cap and Scales

Hope this helps <3
8 0
3 years ago
Read 2 more answers
Explain how iron band formations are<br> evidence for the evolution of Earth’s<br> atmosphere.
Marizza181 [45]

Answer:

Photosynthetic organisms were making oxygen, but it reacted with the iron dissolved in seawater to form iron oxide minerals on the ocean floor, creating banded iron formations. ... The oxygen that is now in the Earth's atmosphere was not there at the beginning.

Explanation:

7 0
3 years ago
The theories on the origin of the universe
olya-2409 [2.1K]

In modern cosmology, the origin of the Universe is the instant when all the matter and energy that currently exist in the Universe emerged as a result of a great expansion.

<h3>Theories about the origin of the universe</h3>

  • may change due to further investigations

<h3>in astronomer proposed a new theory about the evolution of the universe what is the next step the astronomer should take to make his theory reliable</h3>

  • publish the theory in a scientific journal to let people know about it

<h3>where negatively charged particles would most likely be found in an atom</h3>

  • outside the core

With this information, we can conclude that Electrons – Negatively charged particles located in the electrosphere; Neutrons – Neutral charged particles that, like protons, make up the nucleus of the atom. The attraction or repulsion of bodies depends on the nature of the electric charge: Bodies with charges of the same nature (or sign) – repel each other.

Learn more about atom in brainly.com/question/1566330

#SPJ1

5 0
2 years ago
Other questions:
  • How does water polarity affect the way water interacts with different substances?
    5·1 answer
  • What system is used for human reproduction, and what parts does it include.
    15·2 answers
  • Blood flow in the capillaries is
    12·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • What evidence supports the law of conservation of energy? Group of answer choices
    15·1 answer
  • Transgression occurs as a result of a melting glacier. What is the cause of this sea-level change?
    15·1 answer
  • Which of the following statements is true regarding the movement of substances across cell membranes?
    11·1 answer
  • Jajajajajajanjhashdb,jhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
    9·1 answer
  • How far does light travel in one year if 1 earth year = 31,000,000 seconds ?
    11·2 answers
  • How many millimetres (equivalent depth) of water are
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!