1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
8

Question 7

Biology
1 answer:
Debora [2.8K]3 years ago
6 0
B) synthesis reaction
You might be interested in
Match each type of organism to a characteristic that describes it. Produce food from inorganic materials cannot survive in the p
TEA [102]
<h2>Type of Organisam to a Characteristic </h2>

The chloroplast produces food from inorganic materials. Anaerobic organelles cannot survive in the presence of oxygen this is because oxygen does not help in it's growth. Though eukaryotic cells contain cell nucleus. This is why chloroplasts produce food through photosynthesis.  

7 0
4 years ago
Are you inferring when you interpret what you have observed?
-Dominant- [34]

I don’t think so because when you are observing you refer to facts but when you infer you have to hypothesize what the outcome will be

3 0
3 years ago
The ATP made during glycolysis is generated by :
ASHA 777 [7]

Answer:

The correct answer is A. Substrate-level phosphorylation

Explanation:

During the substrate-level phosphorylation, phosphoryl group is directly added to ADP or GDP to form ATP or GTP from phosphorylated intermediate rather than from inorganic phosphate like in case of oxidative phosphorylation.

So in glycolysis 4 ATP are produced by substrate-level phosphorylation. Apart from the 4 ATP, 2NADH are also produced during the glycolysis which is used during the oxidative phosphorylation and produce 4-6 ATP.

So ATP made during glycolysis is generated by substrate-level phosphorylation as ATP is produced by direct addition of phosphoryl group from intermediates.

3 0
3 years ago
What is the major factor that limits the size of cells
dmitriy555 [2]

Answer:

The factors limiting the size of cells include: Surface area to volume ratio (surface area / volume) Nucleo-cytoplasmic ratio. Fragility of cell membrane.

Explanation:

mark me as brainliest pls :)

3 0
3 years ago
America: Love it or leave it!
Savatey [412]
I think the correct answer from the choices listed above is option D. The flawed logic in this statement is an example of a false dichotomy. It is also referred to as false dilemma which involves having two opposite views  in such a way that they seem to be the only possibilities.<span />
4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe the structure of amino acids and the process by which they are joined together to form proteins.
    15·1 answer
  • Biodiversity is one key to the long term sustainability of life on Earth.<br>A. True<br>B. False​
    11·2 answers
  • Why should the distillation apparatus have an opening to the atmosphere at the end?
    6·1 answer
  • In addition to possibly releasing harmful chemicals in the environment, mining is considered
    12·1 answer
  • Which statement best explains why herbivores are not considered parasites? A. They do not harm the plants they eat. B. They do n
    13·2 answers
  • BRAINLIESTTTT ASAP!!!
    13·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • NASA has proposed a mission to one of Jupiter's moons to look for potential signs of life. The spacecraft will have 9,862.5 Joul
    11·1 answer
  • Use the data and what you have learned about evolution to explain how mutation is a random process, but natural selection is not
    9·1 answer
  • Two strains of e. coli—one of which can turn on its lactase production and one that cannot—are grown together with lactose in th
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!