Answer is: a secretary smokes a cigarette in a crowded break room.
External cost Is when consuming a good or servise imposes a cost to a third party. In this case, smoking affects other people in break room, causing pollution and health related problems.
1. is the sun
2. is is waters the plants and help things grow
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: I believe the answer would be 2
Explanation:
Food chain is a hierarchical series of organism each dependent on the next as a source of food while a food web is a system of interlocking and interpendent food chains. on the other hand, energy pyramid as a graphical model of energy flow in a community.
