1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
15

How would a houseplant respond to sunlight that comes from one direction?

Biology
2 answers:
marta [7]3 years ago
5 0
It is C but they don't 'bend' the sun stimulates growth in the plant so it grows towards the light just to be pedantic
ivann1987 [24]3 years ago
3 0
The correct answer would Be C because Most plants would Bend their stems to the sun
You might be interested in
What are grana composed of
kotegsom [21]
They are composed of thylakoids.
7 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Why does a soild changes to liquid when heat is added
sleet_krkn [62]

Answer:

Explanation:

When a solid is heated the particles started to vibrate faster and when it vibrate faster the outer  layer breaks down and change into liquid.So,a solid change into liquid when heat is added.

Hope it helps you:)

5 0
2 years ago
Desean is a student with conduct disorder who fights with other students and is always on the defensive. How can you help Desean
atroni [7]

You would have to teach Desean appropriate social skills.

6 0
3 years ago
Read 2 more answers
Please match the following terms with the appropriate definitions.
Flauer [41]
Distance - an amount of space between two things

Displacement - something that is moved from original place or the area between a object when place in water (volume)

Slope - rise over run or an angle of a line

Sl unit for speed and velocity - meter per second

Sl unit for acceleration - meter per second squared
8 0
3 years ago
Other questions:
  • A construction worker uses a hammer to drive a sharp nail into a concrete wall. What two simple machines is the construction wor
    5·1 answer
  • What do people call an atom that has gained or lost electrons?
    8·1 answer
  • What is the scientific word for a flowering plant?
    15·1 answer
  • Which of the following is an example of a pioneer species that can be seen here
    5·2 answers
  • Which of the following is not true concerning the zebra mussel in the united states?
    7·2 answers
  • Which best describes meiosis?
    15·2 answers
  • which of the combination below features are typically of desert plants.(a)they lose a lot of water through transpiration.(b) the
    5·1 answer
  • Which is an organic compound found in most cells?
    15·1 answer
  • A strand of DNA was unwound and analyzed. If the nitrogen bases of the strand were A-T-C-G-G-A, what was the sequence of nitroge
    11·1 answer
  • Which three of the observed phenomena below offer evidence in support of the Big Bang theory?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!