1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashutka [201]
4 years ago
7

No wrong answers.

Biology
1 answer:
Nutka1998 [239]4 years ago
3 0
Because gases or liquids can't be minerals, and they don't have crystalline<span><span> structures.Hope this helps!!</span> </span>
You might be interested in
The nurse has received physician orders for a patient that she is expecting as an admission from the emergency room (er). the pa
professor190 [17]
Giving the person the wrong meds that he need. 
8 0
3 years ago
Which of the following statements describes integral membrane proteins?
Anestetic [448]

Answer:

The correct answer is option - C.

Explanation:

Integral proteins are integrated proteins that are extended into the cytoplasm from the outer side of the cell. As it is known bilipid layer is fluid in nature it move around the cell layer.

These are the proteins also known as intrinsic proteins that contain parts with the side chains that are hydrophobic in nature. These are tightly located or packed between the hydrophobic amino acids and the membrane due to hydrophobic effects.

Thus, the correct answer is - option C.

3 0
3 years ago
What type of organism would recycle a dead tree in the forest? A) decomposer B) omnivore C) producer D) scavenger
masha68 [24]
<span> A) decomposers

hope this helps </span>
7 0
3 years ago
Read 2 more answers
"While bird watching, Carl hypothesized he could identify 73 different types of birds in one day. He actually identified 65 diff
Brut [27]

Answer:

15.87%

Explanation:

<em>Carl's percentage error would be 15.87%.</em>

From the data, the hypothesized number of birds Carl could identify is 73.

The actual number of birds he was able to identify is 63.

The margin of error between the two = 73 - 63 = 10.

Hence, percentage error = error/true measurement x 100%

               = 10/63 x 100% = 15.87%

4 0
3 years ago
Which would most likely trigger a climate change that could lead to a mass
Elden [556K]
I think Volcanic outgassing
6 0
4 years ago
Read 2 more answers
Other questions:
  • TBH idk what this isss plssss helppp me. I want to learn something. Thnxx
    8·1 answer
  • What are the 3 kinds of blood cells, and what are their main jobs?
    5·1 answer
  • Which of the following is true regarding the global distribution of biodiversity?
    10·2 answers
  • What are the construction of stomata
    8·1 answer
  • what is the effect of molecule size on a molecule ability to diffuse across a semipermeable membrane?
    14·1 answer
  • The table below shows some characteristics of three different types of muscles. Characteristics of Different Types of Muscles Ty
    15·1 answer
  • What are the characteristics of the phylum chordata
    12·1 answer
  • Term for Dominant vs Recessive
    11·1 answer
  • ASAP I WILL MARK BRAINLIST
    6·2 answers
  • You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATT
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!