Although the evidence is only indirect, fever is believed to enhance the body's immune response. The increased temperature may actually impair the replication of infecting bacteria and viruses that are adapted to survive best at your normal homeostatic body temperature range. Hope this helps.
The respiratory system consists of all the organs involved in breathing. These include the nose, pharynx, larynx, trachea, bronchi and lungs. ... The nose, pharynx, larynx, trachea and bronchi all work like a system of pipes through which the air is funnelled down into our lungs.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
The statement that will show the best accurate criteria is patient's respiratory rate is 16 breaths/minute and blood pressure is 130/72 mm Hg.
Explanation:
Adrenergic drugs are drugs that cause the stimulation of the sympathetic nervous system, which is also known as adrenergic nervous system by performing or mimicking the activities of the epinephrine and norepinephrine, or interfering with their release.
It should be noted that, epinephrine and norepinephrine are also known as adrenaline and noradrenaline, this is because they are secreted by the adrenal gland, and this gives rise to the term adrenergic.
Examples of adrenergic drugs are phenylephrine, clonidine and oxymetazolin among others.
