1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OverLord2011 [107]
3 years ago
7

True or False? In the complete dominance pattern of heredity the dominant allele, if present, determines the phenotype.

Biology
1 answer:
Cloud [144]3 years ago
5 0

Answer: True

Explanation:

You might be interested in
Which of the following most likely represents a prototype for the concept indicated in parentheses?
garri49 [273]

Answer:

A golden retriever.

Explanation:

Prototype may be defined as the member among the group that is characterized as more central than the other member of the group. Prototype can be used in the taxonomy as well as in the evolutionary history as well.

The prototype is the main representative member of the group. The golden retriever dog is the most common member among all the members listed in the question. Hence, the golden retriever (dog) is considered as the prototype.

Thus, the correct answer is option (e).

7 0
3 years ago
Hypothesis question: do people sing along more to the radio before they eat or after they eat?
Lelu [443]

Answer:

They will sing more to the radio after they eat.

Explanation:

This is because they have more energy in their system and are happy from eating so will enjoy the radio more

3 0
2 years ago
Read 2 more answers
DNA is a nucleic acid found in all living cells. What is one reason DNA is linked to all body functions? A DNA secretes the prot
Lady_Fox [76]
C. It is DNA that provides the information needed to make proteins, which are essential for life. They do this by containing all genetic information


6 0
3 years ago
How is excretion carried out in reptiles that live on land
joja [24]
<span>Reptiles that live on land convert the ammonia in their unrine to uric acid, which is much less toxic , so it doesn't need to be diluted as much. Also excess water is absorbed in the cloaca, reducing the urine to a paste and conserving water.</span>
7 0
3 years ago
Read 2 more answers
When Chris describes the practices, values, and goals shared by a group of people, Chris is referring to their
Katyanochek1 [597]

Answer:

This question lacks options; they are

A) Moral

B) Culture

C) Society

D) Civilization

The answer is B. Culture

Explanation:

Culture refers to the customs or habitual practices of a group of people. It describes the beliefs, values, goals etc which is peculiar to a group of people or individuals. For example, the dressing, religious practices, music etc common to a group of people is their CULTURE.

Based on this explanation, the practices, values, and goals shared by a group people as described by Chris is referred to as their CULTURE.

7 0
3 years ago
Other questions:
  • A reform in the Second New Deal that helped millions of retired Americans with financial difficulties.
    6·2 answers
  • Does genetic influence affects the human brain's development
    13·1 answer
  • How does capillarity help sustain life?
    10·2 answers
  • Which of the following is a good reason to use a simulation in an experiment?
    12·1 answer
  • When a business has plants located in several foreign countries without ties to any specific nation or region, it is called a(n)
    5·1 answer
  • How does a fish swim
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which of the following is not a reason that cane toads became an invasive species Australia?
    7·2 answers
  • Which of the following is not a possible pollutant?
    7·2 answers
  • What advantage does a reliable web page have over published textbooks and
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!