1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
8

Which one of the following human organ systems is mainly made up of glands and hormones? A. Endocrine system B. Excretory system

C. Nervous system
Biology
2 answers:
aniked [119]3 years ago
7 0

Endocrine system is the human organ system that is made up of glands and hormones.

Option A

<u>Explanation</u>:

The "endocrine system" is responsible for secretion of hormones inside the body and it is made up of endocrine glands such as thyroid glands, pituitary glands, pineal gland, adrenal gland, pancreas, ovaries and testes. These glands releases hormones into the blood to target organs which are situated at a distance or into nearby tissue to target nearby cells or to target self. Endocrine glands works by forming negative and positive feedback loops to regulate the proper functioning and effect of the hormone on the target organ or cells and for control the production of hormone from the glands itself.

GrogVix [38]3 years ago
5 0

Answer:

A. Endocrine

Explanation:

The endocrine system is a collection of glands that produce the hormones that regulate metabolism, growth and development, tissue function, sexual function, reproduction, sleep, and mood, among all the other things

You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Who derived benzene
Akimi4 [234]
The scientist, kulele', spelling may b wrong...1800's...............
3 0
3 years ago
!00 pointzzz<br> Help me nd yeahhh!! (see attachment)
lisov135 [29]
Here’s what I found on quizlet

3 0
3 years ago
Read 2 more answers
5. List three mechanisms by which Earth's albedo can be increased.
KIM [24]

Explanation:

1. A decrease in the number of greenhouse gases that humans produce will result in lowered global temperatures. This will allow the ice sheets in the polar regions to increase increasing also albedo.

2. Using light-colored building materials on houses and pavement in urban centers will work towards increasing albedo as more sunlight is refelcted back by built environments.

3. Decreased deforestation/increase in aforestation increases the earth’s sirface albedo because vegetation reflects back more sunlight than the earth’s bare surface.

6 0
3 years ago
What are the alternate energy sources that are starting to replace the use of coal in the U.S.?
morpeh [17]
Because if we use too much coal we are wasting fossil fuels and burning coal hurts the environment so the alternative energy sources provide clean energy
3 0
3 years ago
Read 2 more answers
Other questions:
  • Chemical reactions in cells are faster than the same reactions outside cells. True or false?
    7·1 answer
  • Identify the primary role of the lymphatic system? a) Delivery of oxygen to the deep muscle cells b) Produce and store large num
    12·1 answer
  • In what way are elements in the same column of the periodic table the same?
    5·1 answer
  • What determines the path that an object in projectile motion follows?
    10·1 answer
  • Once the dye had been applied to the shirt, all that remained was to ______ it.
    15·2 answers
  • The fundamental source of Energy for all biological System is<br>​
    12·1 answer
  • PLEASE HURRYY
    10·1 answer
  • What is the goal of applied science
    14·1 answer
  • Example of the word reflection in science
    7·2 answers
  • As a dental assistant you are responsible for mounting radiographs, what are helpful hints when
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!