1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
10

The cycads, a mostly tropical phylum of gymnosperms, evolved about 300 million years ago and were dominant forms during the age

of the dinosaurs. Though their sperm are flagellated, their ovules are pollinated by beetles. These beetles get nutrition from the pollen and are sheltered from the microsporophylls. Upon visiting megasporophylls, the beetles transfer pollen (containing the flagellated sperm) to the exposed ovules. In cycads, pollen cones and seed cones are borne on different plants. Which feature of cycads distinguishes them from most other gymnosperms?
Biology
1 answer:
Andrei [34K]3 years ago
8 0

Answer:The Cycad tree is the sporophyte.They have flagellated sperm.

Explanation:

During pollination, the contents of the megaspore divide to form many–celled gamateophyte called the endosperm and archegonium. There is a micropyle opening with a sticky fluid, which traps the wind-borne male gametophyte (microspores) which,at this time is made up of prothallus cell;an antheridial cell and a large tube cell. The trapped microspore is sucked into the archegonia chamber. Antherizoids are released, but only one penetrates each oospore and fuses with the female nucleus. The zygote is formed in the ovule and the later develops into seed.The diploid seed germinates into a new sporophyte plant and the life cycle begins again. Examples of cycad include Cycas circinalis ,Cycas celebrical and Cycas revoluta

You might be interested in
A farmer ,sangay , plants chilli in the first year .He than plants beans in the same field next year ..
Gnom [1K]

Answer/Explanation:

Chilli and Beans are two different groups of crops having different nutrient requirement for them to grow well.

Beans is a leguminous crop that can help fix nitrogen back to the soil after the soil nitrogen content has been depleted by crops that use up nitrogen in the soil.

So, one of the possible reasons why Sangay plants Chilli the first, and beans the next year could be to ensure optimal productivity, as beans would replenish the soil with nitrogen. Also, both crops have different nutrient requirement. Nutrient requirement for both crops vary.

3 0
3 years ago
Why would it be advantageous to observe mold colonies on an agar plate?
Alika [10]
I think it would be advantageous to observe mold colonies on an agar plate because one is able to observe colony structures, pigmentation, among others.  Colony forming units are the individual colonies of bacteria,yeasts or mold. A colony of bacteria or yeast refers to a mass of individual cells of same organism, growing together. 
8 0
4 years ago
Read 2 more answers
If you know the answer to this question please help!! ASAP I will give brainiest!
sleet_krkn [62]

Answer:

The answer is "Photosynthesis creates glucose (sugar) which is used in cellular respiration."

Explanation:

Photosynthesis makes the glucose that is used in cellular respiration to make ATP. The glucose is then turned back into carbon dioxide, which is used in photosynthesis. While water is broken down to form oxygen during photosynthesis, in cellular respiration oxygen is combined with hydrogen to form water. While photosynthesis requires carbon dioxide and releases oxygen, cellular respiration requires oxygen and releases carbon dioxide. It is the released oxygen that is used by us and most other organisms for cellular respiration. We breathe in that oxygen, which is carried through our blood to all our cells. In our cells, oxygen allows cellular respiration to proceed. Cellular respiration works best in the presence of oxygen. Without oxygen, much less ATP would be produced.

Learn more at https://flexbooks.ck12.org/cbook/ck-12-middle-school-life-science-2.0/section/2.17/primary/lesson/connecting-cellular-respiration-and-photosynthesis-ms-ls

Hope this helps and brainliest? Thanks.

8 0
3 years ago
Read 2 more answers
Synovial fluid; __________.a. is a double layer of tissue that encloses a joint b. lines the joint everywhere except over the ar
Nadusha1986 [10]
<h2>c) option is correct </h2>

Explanation:

  • Each synovial joint has a fibrous capsule surrounding the joint, which helps hold the bones together, along with the ligaments (which join bone to bone) and tendons (which join muscle to bone)
  • The joint capsule is lined by the synovial membrane, which manufactures the synovial fluid
  • The synovial fluid is located within the joint cavity of a synovial joint and has three primary functions:  Lubrication , nutrient distribution  and shock absorption

4 0
3 years ago
The bond between H and H?
aev [14]

Answer:

O

Explanation:

6 0
3 years ago
Other questions:
  • Which of the following represents an abiotic component of a forest community? A) the oak and hickory trees B) the mushrooms grow
    8·1 answer
  • 3 reasons cells need atp?
    14·1 answer
  • What do goblet cells and cilia have in common?
    11·2 answers
  • Also known as the variety of life? ​
    6·1 answer
  • _____ classifications suffer from problems of convergent and parallel evolution.
    15·1 answer
  • Which statement describes one thing that must happen during the founder effect?
    9·1 answer
  • Transitional. ELL differ from epithelial cell in that they
    6·1 answer
  • Which Element?<br><br> The diagram shown is an example of which element? Explain<br> how you know.
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following types of specialized cells are only found in plants? A:Phloem B:Glandular C: Muscle D: Nerve
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!