If an ecosystem lost its producers, there would be no way for energy to move up the web and the ecosystem would most likely fail. Without these energy-capturing organisms, herbivores would get no energy or food. Without them, carnivores would get nothing as well. Because decomposers get energy from all three, they would also die out.
If only decomposers were removed, there would be a lack of nutrients in the soil for plants. This would result in the above (loss of energy, food, and other commodities).
I hope I helped!
The genotypes would be bbTT X BbTt
Assuming that bark color is represented by B (b) allele and height is represented by T (t) allele.
Since the traits show simple dominance: blue (B) of dominant over purple (b) and tall (T) is dominant over short (t)
- The genotype of a tree that is purebred purple (bb) and tall (TT) would be bbTT
- The genotype of a tree that is heterozygous for both trait would be BbTt
- Thus, the cross would be bbTT x BbTt
More on genotypes can be found here: brainly.com/question/20730322?referrer=searchResults
Animal cells migrate during morphogenesis. not plant cells
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
<span>Potatoes are also known as tubers and they commonly make up most of the carbohydrate needs that the body can get from food. It is made up of parenchyma tissue that makes the plant have the ability of cloning and low metabolic activity. They are commonly used for experimentation as a “model tissue” because of these characteristics. <span>
</span></span>