1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
13

Explain different ways that carbon can get trapped in the long-term carbon cycle. ​

Biology
2 answers:
irga5000 [103]3 years ago
4 0

Answer:

Alright, sure thing.

Explanation:

Carbon that is a part of rocks and fossil fuels like oil, coal, and natural gas may be held away from the rest of the carbon cycle for a long time. These long-term storage places are called “sinks”. When fossil fuels are burned, carbon that had been underground is being sent into the air as carbon dioxide, a greenhouse gas.

TL; DR, Carbon that is a part of rocks and fossil fuels like oil, coal, and natural gas may be held away from the rest of the carbon cycle for a long time.

earnstyle [38]3 years ago
3 0

Answer:

cArBoN iS bAd fOr YoU

You might be interested in
Which of these molecules is not a product of the Electron Transport System?
ycow [4]
NAD+is not a product of ETS
3 0
3 years ago
Do you think an organism with 1200 chromosomes would be more complex than one with 46 chromosomes?
algol13
Not necessarily as many plants have double or quadruple the amount of their DNA each time they reproduce (polyploidy). This phenomenon doesn't in fact change them.
This best seen when you think about some diseases seen in humans like Down syndrome where there is an extra chromosome 21, but this addition (aneuploidy) did not add to the complexity
3 0
3 years ago
Pls help thank you
kvv77 [185]

Answer:

Forms of fossils and there arrangement with layer of rock.

Explanation:

  • The seashore is a significant place for the depositional work of waves and it's also one of the significant places for the erosion and weathering of rocks.  
  • The presence of sedimentary rocks along the cliffs are essential for the discovery of fossils of plants and animals. Fossils of shells and other creatures that were of marine origin are mostly discovered near excavation sites. Fossil helps to prove the age of rocks and strata.
5 0
3 years ago
Janis tore a ligament in her ankle. Until the injury heals, she is at most risk for which of the following? dislocating bones lo
bulgar [2K]

Answer:

The correct answer is ''dislocating bones.''

Explanation:

When the bone " pops out" or dislodges from its place (joint), a dislocation occurs. An ankle dislocation, like any other joint, occurs when the 2 articular surfaces of the ankle separate, in this case when the talus ( together with the rest of the foot) " pops out of place" and is no longer in contact with the surface of the tibia-fibula. This leads to the complete breakdown of the ligaments that hold the joint in place, causing the bones to " pops out." Producing significant deformities in the affected joint.

5 0
3 years ago
Read 2 more answers
Which statement best describes what happened when Constantine tried to establish "New Rome"?
saul85 [17]
D. He was successful in building s new political center in the East, unified by the Christian religion.

This question refers to the Byzantine Empire, which lasted past the fall of the Western Roman Empire.
8 0
3 years ago
Other questions:
  • A boy with Klinefelter syndrome (47,XXY) is born to a mother who is phenotypically normal and a father who has the X-linked skin
    7·1 answer
  • A nurse caring for a pregnant client suspected substance use during pregnancy. what is the priority nursing intervention for thi
    8·1 answer
  • These cellular structures increases the superficial surface area of a cell._______________
    8·1 answer
  • the growing parts of grasses are underground.they can quickly grow back after a fire this helps them in the...
    8·2 answers
  • The heart is part of the cardiovascular system and is made of cardiac muscle. Cardiac muscle has special characteristics that di
    15·2 answers
  • From where to do most producers get energy?
    8·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Give an example of a specific joint in the human skeletal system.<br> Please help
    15·2 answers
  • What causes Swollen Shoot Disease?
    13·1 answer
  • Which of these observations gives the most support to the endosymbiotic theory for the origin of eukaryotic cells?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!