1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
4 years ago
5

The lysosome functions in a cell like the _______ does in our bodies.

Biology
1 answer:
Troyanec [42]4 years ago
4 0
Lysosomes remove waste at a cellular level.
They contain digestive enzymes, so they're like the digestive system.
The stomach digests food, so lysosomes could be considered like the stomach.
But then again, so do the intestines, small and large.
Since the stomach doesn't also work to remove waste though, I'd say the answer is probably large intestine, which finishes the digestive process and removes waste material.
You might be interested in
One drawback of dams is that they can flood land upstream from the dam and reduce water flow downstream from the dam.
Andrei [34K]
The answer provided would be true
3 0
3 years ago
Growth hormone is secreted by the ________ while we sleep.
mihalych1998 [28]
The answer would be pituitary gland.

Completed sentence: Growth hormone is secreted by the pituitary gland while we sleep.
4 0
3 years ago
What is the most likely reason that horses and mountain goats have hooves?
melisa1 [442]
<span>a. They have homologous structures because they have a common ancestor.

</span>
8 0
3 years ago
Read 2 more answers
In fruit flies, the allele for white eyes is recessive to the allele for red eyes. In a generation of fruit flies, 45 males with
podryga [215]
<span>heterozygous / homozygous refers to whether both alleles for a gene are the same. The organism is homozygous if both alleles are the same - that is, either both are dominant or both are recessive. The organism is heterozygous if the alleles are different - that is, if one allele is dominant and the other allele is recessive..
 the answer to the questions is A. </span><span>One parent was heterozygous for eye color and the other was homozygous with red eyes.</span>
7 0
3 years ago
Read 2 more answers
Which of the forest management practices keeps the florist in a state of mid to late succession
Ivahew [28]

D. seed-tree cutting

3 0
4 years ago
Other questions:
  • The nurse should review which lab result before advising a client about taking the first dose of ibandronate (boniva)
    5·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which of the following mutations could lead to constitutive expression of the genes of the lac operon?
    8·1 answer
  • You have just delivered a premature baby. Your assessment reveals that he is breathing adequately; however, his heart rate is 90
    9·1 answer
  • _____ refers to the special bond that develops between an infant and his or her primary caregivers and provides the infant with
    7·1 answer
  • Can somebody help me match them
    6·2 answers
  • Calculate the approximate diameter of the field of view occupied by the flea. The diameter field of view at 100x magnification o
    6·1 answer
  • ¿Qué áreas del conocimiento me pueden <br> aportar a la ejecución del proyecto? para un huerto
    8·1 answer
  • PLZ HELP 46 POINTS WHOEVER ANSWERS GETS BRAINEST !!! What happens before mitosis occurs?
    10·1 answer
  • (IM SO CONFUED ON THIS I NEED HELP ASAP)) HELP NEEDED ASAP!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!