<span>Assuming you mean damage to human-built structures, you need to consider factors such as soil thickness, soil composition, soil sub layers, depth, type of displacement, range from the epicenter, and various architectural and engineering characteristics of the structures. </span>
Answer:
CHICKENPOX
Explanation:
Varicella-zoster virus (VZV) causes chickenpox and herpes zoster (shingles).
CHICKENPOX follows initial exposure to the virus.
After the chickenpox runs its course, the virus retreats to nerve tissues near the spinal cord and brain, where it hides out.
Reactivation of the dormant virus results in the characteristic painful dermatomal rash of HERPES ZOSTER, which is often followed by pain in the distribution of the rash (postherpetic neuralgia).
Reactivation can be due to:-
1) A weakened immune system, which can wake the virus up
2) Cancer, HIV, or another disease that lower your body’s immunity
3) Being 50 or older
4) Being under a lot of stress
5) Past physical trauma
6) Taking long-term steroids or other medications that can weaken your immune system.
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Answer:
<em>The correct options are B and C</em>
Explanation:
Option A is false because bacteria fix nitrogen by converting it into ammonia. The ammonia is used by the plants for different functions like development etc.
Option B is correct because plants can take up both ammonium ions and nitrate ions from the soil. They use these ions to make amino acids which are required by the plant for different activities.
Option C is correct because nitrifying bacteria are the bacteria which convert ammonia into nitrites and then nitrates in a process which is termed as nitrification.
Option D is false because herbivores eat plants to make amino acids and proteins.