Answer:
Cuando la tasa de natalidad supera con creces la tasa de mortalidad, la población se dispara. Duplicar el tiempo es la cantidad de tiempo que tarda una cantidad en duplicarse y se utiliza en demografía para proyectar cambios futuros en el tamaño de la población.
Explanation:
imma be honest I have 1 IQ to understand stand that
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
Oceanic water have latent heat or special heat capacity.
Explanation:
- As oceans cover nearly 71% of the earth's surface and help in regulating the climate and weather patterns around places. They have specific heat and contain salt contents.
- They trap and absorb the carbon dioxide and thus are called carbon sinks. They take up a large amount of solar energy and heat slowly as compared to the land surfaces.
Answer: Plastic Pollution
In 1950, the world produced more than 2 million tons of plastic per year. By 2015, this annual production swelled to 419 million tons and exacerbating plastic waste in the environment.
A report by science journal, Nature, determined that currently, roughly 11 million tons of plastic make its way into the oceans every year, harming wildlife habitats and the animals that live in them. The research found that if no action is taken, the plastic crisis will grow to 29 million metric tons per year by 2040. If we include microplastics into this, the cumulative amount of plastic in the ocean could reach 600 million tons by 2040.
Shockingly, National Geographic found that 91% of all plastic that has ever been made is not recycled, representing not only one of the biggest environmental problems of our lifetime, but another massive market failure. Considering that plastic takes 400 years to decompose, it will be many generations until it ceases to exist. There’s no telling what the irreversible effects of plastic pollution will have on the environment in the long run.
