1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goblinko [34]
3 years ago
13

Your teacher asked you to divide the fish you see here into groups. What property would you MOST LIKELY use to begin dividing th

e fish into smaller groups? A) body color B) body shape C) tail or no tail D) stripes or no stripes
Biology
2 answers:
zheka24 [161]3 years ago
8 0

Answer:

A

Explanation:

spayn [35]3 years ago
6 0

Answer: B. body shape

Explanation: The BEST property would be the body shape to begin dividing the fish into smaller groups

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A forest is cut down to make room for a housing development. Which population is most likely to survive?
Darya [45]
A because they can eat out of the trash where the others require thenforest to live. Hope this helped.
6 0
3 years ago
Read 2 more answers
Sampson is a dolphin trainer who trains his dolphins to perform tasks by blowing a high-pitched whistle immediately after the do
irina1246 [14]

Answer:

Based on this, you know that Sampson is using the whistle as a <u><em>secondary </em></u> reinforcer to train the dolphins.

Explanation:

Secondary Reinforcement can be described as a condition in which  a stimulus initiates a behavior after being previously associated with a primary reinforcer. A secondary reinforcement is a stimulus that satisfies basic survival instinct such as food, drinks, and clothing.

The same phenomenon was being used by Samson to train his dolphins to perform tasks. The dolphins enjoyed the sound of the whistle because previously that sound was paired to them getting their food.

8 0
3 years ago
During photosynthesis energy from the sun is trapped in quizzz.
Anna35 [415]

Answer:

Chlorophyll

Explanation:

Most plants contain a special colored chemical or pigment called chlorophyll that is used in photosynthesis. Chlorophyll is what absorbs the sun's energy and turns it into chemical energy.

Request: Please mark me as the Brainliest.

3 0
2 years ago
The tRNA lines the amino acids up to form...
ivanzaharov [21]
2, they line up to form a polypeptide chain this forms part of a protein molecule.
3 0
3 years ago
Other questions:
  • Why is the sky blue? wrong answers only
    14·2 answers
  • Which is an environmental factor that affects skin color in humans?
    14·2 answers
  • Can someone help me please
    7·2 answers
  • Consider the diagram of the Earth, Sun, and Moon system. Which phenomenon is MOST DIRECTLY caused by the revolution of the Earth
    9·2 answers
  • Ribs that are not attached to the sternum at their anterior costal cartilages are known as1.vertebrochondral ribs2.vertebrostern
    5·1 answer
  • Homologous pairs of chromosomes are lined up independently of other such pairs during _____. prophase II telophase II metaphase
    8·1 answer
  • Explain how predation, disease, and competition impact a population-based upon scale and distribution of the organisms.
    11·1 answer
  • My parents are too hard on me to get good grades and it stresses me out. Help!
    6·2 answers
  • A farmer has a breed of yellow tomatoes. However, the farmer thinks that they would sell better if they were bright red. 1. Expl
    5·1 answer
  • Palliative radiation treatment may: Group of answer choices remove the tumor. divide the tumor. shrink the tumor. enlarge the tu
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!