1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
8

Which of the following map projections is popular because it keeps all areas slightly distorted, creating a visually appealing m

ap of the entire world?
A.

Mercator


B.

Mollweide


C.

Robinson


D.

Goode
Geography
2 answers:
artcher [175]3 years ago
7 0
The correct answer for the question that is being presented above is this one: "C. Robinson." T<span>he map projection that is popular because it keeps all areas slightly distorted, creating a visually appealing map of the entire world is the Robinson</span>
777dan777 [17]3 years ago
7 0

Answer:

its C on edg

Explanation:

You might be interested in
In what region is each state located?
Naya [18.7K]
Alabama-south
iowa-midwest
maryland-northeast
michigan-midwest
new jersey-northeast
new mexico-west
vermont-northeast
washington-west





5 0
3 years ago
Read 2 more answers
Which volcanoes are located along converging plate boundaries? ACCORDING TO THE PICTURE.
Ivenika [448]

Answer:

mark as brainlist

Explanation:

Volcanoes at convergent plate boundaries are found all along the Pacific Ocean basin, primarily at the edges of the Pacific, Cocos, and Nazca plates. Trenches mark subduction zones, although only the Aleutian Trench and the Java Trench appear on the map in figure 1. Remember your plate tectonics knowledge.

4 0
3 years ago
PLEASE HELP!!! I WILL GIVE BRAINLIEST!!
mamaluj [8]
B, d. is earth's orbit around the sun
7 0
4 years ago
What is a seismometer, how does it work, what does it do, what was the worlds 1st seismometer
shutvik [7]
Seismometers are tools which measure motion in the ground including seismic waves generated by earthquakes, volcanoes, and other activities which might create seismic waves. Seismometers measure any movement of seismic activity in the earth and today this is done by electronic means whereby the machine measures any changes in seismic activity in the surrounding areas of the seismometer. The first seismometer is believed to have been invented by Zhang Heng of China's Han Dynasty in 132 AD. 
6 0
4 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Archaeologists refer to the period of time before people invented writing systems as?
    15·1 answer
  • What are some differences in mountains and volcanoes
    5·1 answer
  • Which of these is a behavioral response that is determined by heredity
    13·2 answers
  • Rill erosion can eventually evolve into A. a delta. B. gully erosion. C. a stream. D. a tributary
    8·2 answers
  • What is the difference between space satellites and space probes?
    6·1 answer
  • The terms foliated and nonfoliated describe the _____ of a metamorphic rock.
    14·2 answers
  • Need help with this!
    9·2 answers
  • List 6 careers in geography​
    9·1 answer
  • Which is small National Park?​
    11·2 answers
  • Find the length of AB
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!